Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F11C1.6   

sjj_F11C1.6 RNAi (6)
PCR_productsjj_F11C1.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F11C1.6 Source_evidenceePCR719WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRX1301041313011501
Overlaps_transcript (5)
WB_DNA_textsjj_F11C1.61089atcaacctccagagcaccaggtttcaagcaggtgagctttatttcttatatttctttcaacttatcaatctcatatttcagcacaactgaccagaacaaccaaatcaactattttgaccaaactaaaatcaaaactgaatatatcaaaactgagtatgatgcacatctccagagtccaacattgtccagtagcactaatcagcagcgtaagaatattttctggagttgttaatagcatcaaattataaatttcagtttctgtttccgattttatcatgagacctggatacttagttgacccacaagacagcttggcagtacttcttgggagcacaattgacgacccacttctcaggcataccttcccagcagcttatcagttgaatgaagtcaaacaggagccatttgactattcggagcagttcattcatcactcattgcacgactatccaacttataccagcaacactaccaattatgctacaatgatgccaatgacaactgtttccagcacacaatccttggtcacttcgacttcttctagtaagttttagtttttttatcgctttttcttgtcttcagtttatagtttcaacatttcaaatttttgattaagtttttttttaatttttgaaatgttaacattacttaatttcagcaacaactggccgaatgacagaagctagcagcacatcaccaattctcccactttgcccagcaccaactgaaaaaacggtggaccacttttacaacagctcgatcgccgaaatgtgcaaaacattacccgatgatgctcaaattgctcgaattttcacaagcgtaaaaggaactagcaaacctgaaaagcacgcattttccattcaagtcgcagaggaaaatttgaaagatatcgtgatttgggcaaaaaatgatcaactattcagcaaattatcggtaaaataatacatacaacaatataataatctaggcactctcatttcccaccagcggtttttttctaatatttttattctctatttcccaccctgatgagatgggaataatgtagataaattgctcgcttccggtgatcaaaagaaacaatcgccg