Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: sjj_F11C1.6_b   

sjj_F11C1.6_bSequenceATCAACCTCCAGAGCACCAG
PCR_productsjj_F11C1.6