Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F11E6.6   

sjj_F11E6.6 RNAi JA:F11E6.6
Simmer:F11E6.6:Repeat_a
Simmer:F11E6.6:Repeat_b
Simmer:F11E6.6:Screen
PCR_productsjj_F11E6.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF11E6.6 Source_evidenceePCR759WS150 Sequence/Annotation Release
Overlaps_Gene F11E6.6 Source_evidenceePCR759WS150 Sequence/Annotation Release
Chunk_score Abs_score633
Max_abs_score633F11E6.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV1746447817465982
Overlaps_transcriptF11E6.6 Source_evidenceePCR759WS150 Sequence/Annotation Release
WB_DNA_textsjj_F11E6.61505agagaatctacggaaaccgaatccagaaattgctattcaatattattgttcatcatatcatcatcattattctcgttctccaaaataggtgtgttatcggcttcgtcagatctcacaaaaacgaccttcggagagtgaagatatgagaaccgaagctcgatgaaaaacgtgatgatgaaaacgtggaagcatactgaaagttttttttgatgtgtgaattgaaaaagttttttttgatgtgtgaattgaaaattttgcttacttgcaataacccatagacttgcttctagaagccacggaggggaaagattcacatcatcttttacaaagcgatctgaaaaactctttgaacattatgggccacagaaaatattcccttttgaaactgacatgaaacgcttattaaaaacctctccgctccaaactatcaatttcgtttgttattccgcagtaaaaaccgtagctcaaacgtttttaattagtttcattttgccagttttcaaacatttttcgtcgtttatgtgatctgcttcgttgttccgttaacttttattcaaaaatcacatcaataatttatataaattaatcaaataaaattcaaaaatatatgaaaaaaaaccgtatctatttgtcaacttcacatgcatttttagcagtacttcgccatcacgccctcatcacaaattgtgattcacaatgtgaggtgacgacgatccaataagttttggaacttacaaaatatgaaggccacggtttctattagcgctattgtgaaccgaaatatgcaaactttgagagtgcacatacgtggaactagagcccaagtaagtactgcttgagaccacgcataaagtaaccctgcactgaaagctatagtgtccgccaagtcatgcacaattgcaagttgaggatcctgaaaacatatttttaaaaaatcttccaaatggtctaaaatacctcacaatgtgcgattacggtaatacaaagagctgcaaaaaacccgattcccgctattattgtggacatcagacgccagacggagttctcccatccaagccgatgagcgtaatattcaacagtttggcgatgccgtatgtaagcgatcagcattacttgaataaaatttgaggttatttgaatccttcggtctagagacttacacataaacgcagaatagctgacaagatgagcaaatacgcattcaccaaatagtgatgcatcacgggacgcaagaaacggtagaatatgaggatatttcttaagaagagaaacaaaaaaatatctgaaattaaatagttttcgttcatcaaactatcttcaaattagaaatgtactttgttgcagtggcggaaattgcacacaaaccgtaaaatattggtataagccagatttttgtgagaaccatcctaaaaaatccatgtaaattatccaaaagatgagttgctactcgttaaaagtatttagaaccgggaaaaatgtgaaattgcgaaactagtgtggtgagt