Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F11H8.4   

sjj_F11H8.4 RNAi JA:F11H8.4
Simmer:F11H8.4
PCR_productsjj_F11H8.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS F11H8.4a Source_evidenceePCR1033WS150 Sequence/Annotation Release
F11H8.4b Source_evidenceePCR1033WS150 Sequence/Annotation Release
Overlaps_Gene F11H8.4 Source_evidenceePCR1033WS150 Sequence/Annotation Release
Chunk_score Abs_score970
Max_abs_score970F11H8.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII70247007025825
Overlaps_transcript F11H8.4b Source_evidenceePCR1033WS150 Sequence/Annotation Release
F11H8.4a Source_evidenceePCR1033WS150 Sequence/Annotation Release
WB_DNA_textsjj_F11H8.41126cttgaccaacgactcccaatcgtttttcatctttccacacattgacgaaactgtggagaactctttgacagctttttcgtggaacggccgcatcttctcgtcgaataaatcacgttctccttgaattttgtacacttttaagcagttctccagttttttaatgttattctctgtcagttgaacagtttttcgaatttcatccgcattcactcgggacgattcaatgcaatgatggaagtcggtgagagcaaatcttaaattttttaaattttgagaaagcaagtaaaggaatctactcaccgtgctcgtcttggatcgattctcttcatttcttcaattaaatgatgtagaagagtatgccgattatcgacatcttttgtatcaaccagtcttgtcagcattctcatgtcgaacgcgtaagcactcgaatagttttttgtcgctccgcccataaagtttccagtcgccaaaacaagtttcaaaaatgttcggaatccttcagatgctcgtacttcttcgcacgcttccatcactgacgacatggctggtttcagttcattcaacacttcagagaatcgcattttgaatagaaccaagtcgagacgaagcggaagaccttgaatttggagcagacgagtgacaaattgttcaccctcgggcatttcctcaaattgagccttgttcaccgctctcagcttgtcaataagctccttctccactggcattgctgatcgaagttgctccaagaatccgacagttaaaaccttttcgttgacttccaaaatcgccagcttgagctctgaatgcgacattttgattgatccttgaagaatgcctgcaagaaaaagatcataaaaaaggatatacttcttcgagtttacccaatttttgaagtaatttatcgtcatgaatgacttgtgctgtcttcactttctttttgctattcaagacaccaccaagagtaccactatttgcagcaggtttcgtggcgaatttggttcgtaaacgatcgaacattcgatcgctggtcagctgttcttcgtttgttccaacccagaacgactctcttggaatatcccgagggttgatagtatgtgctccccatgggaactttctcatgggacca