Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F12B6.2   

sjj_F12B6.2RNAiJA:F12B6.2
PCR_productsjj_F12B6.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS F12B6.2a Source_evidenceePCR777WS150 Sequence/Annotation Release
F12B6.2c Source_evidenceePCR777WS150 Sequence/Annotation Release
F12B6.2d Source_evidenceePCR770WS150 Sequence/Annotation Release
Overlaps_Gene F12B6.2 Source_evidenceePCR822WS150 Sequence/Annotation Release
Chunk_score Abs_score717
Max_abs_score717F12B6.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI22522812253975
Overlaps_transcript (5)
WB_DNA_textsjj_F12B6.21695atctttggatgctccacgacacgcgtggcctagaaacccaaaaaaaaaacctcttccaggcttcgtaatccccgctggaagtgtgctcatctcgtcttggttcccactttccgagaaaagcacggccatggcaatattcacaacgggaaatcagattggaatcgccgtttccatgttcctaacggcaaagctttgtcagcttcattttttcgaagggtggccgctggtttttatagtttacgggctcattggagcagttttcttggtgatttggcatgttaggctagcggataagccaagggagtcgaaatatatcacagcgacagagttgacctacatcaaaggcgggaaacagagaagaaaccgagcagagactatcgttagagcaactccttatatgaaggtgagcgtggaagagtttttgatttttctaggccatgtgcttatacactgaacatttaactgagccttttttcttcagtctaaaacaatcaatttttgagtattctgtttaaacatgttgaagaaaaatagcaggaaagatagctggcctagaaacccaatggaaaagtttcctaggccacaaactctgtatttttcagattatcctcaacggttgtgtctgcgccatctgtgcgtgttcatttgctcaaagtttcgtccttgtggctctggtgacctatcttccaaagtataatcaaatcgcgttcaagatgaatttgacgcatgtgggtttttttggggtaacaatttattttttacaaattaagcaaattccagaacggaatttggtcttctcttccatttttcatccaaatgatcaccaaattgttgttcgcgattattgcagacaaggttaagcagcgaaaagtgaatgcaaccgcagttacgaaggtctcaaatgctattggtgagttgggtggcctagaaaatctgtcgcgtggaagaggaatggcgtcatagatggcctagaaactcccactagtggaagaagagtgacgtcatagatggcctaggaacttcactgtgtgggaaaaaatgacaaaaatataaatggcttaggtggcctagaaactccctcgggtaaaagtaagaatgatgacgtcatagctggatgacctagaaacccccatggctgctggtgtaagagagtctcagtagatctacaaaaaatgcgggagaagagatgcagacatctcaactgatttcgcgtgtttaagaacgtgtgctgacgtcacatctgggcaaaatattcccgcattttttgtaggtcaaaccgtaatggggcagcctggcaccacgtggccatagccgataccatgacgtcatttttaaccgaactctttacgtttcaaagtactctaacccacaccacttggatgtgacgtcaccggtggcctaactttcccattttcagccagttttgccagcgcaatcttcattgtgatcgccgcctacggcccgtttgacagtgccgaactcgtccagctgagcataattgtatcgatggcggcgttctcggcatatgttcccggatacaacacatcgattgttacggtggctccgcaggtttgtgtggtggcctagaaatcagaaattacaaaagtcttctgcatgattttcagcgaaaaaaaaaatcgtaactagagaaaaaattgcaaattttgcagttcaccgcattcatttcgtcgtatg