Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F13B10.2   

sjj_F13B10.2 RNAi JA:F13B10.2
Simmer:F13B10.2
PCR_productsjj_F13B10.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF13B10.2c Source_evidenceePCR697WS150 Sequence/Annotation Release
Overlaps_Gene F13B10.2 Source_evidenceePCR880WS150 Sequence/Annotation Release
Chunk_score Abs_score817
Max_abs_score817F13B10.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII38683883869555
Overlaps_transcript (5)
WB_DNA_textsjj_F13B10.21168aaggcattttgttcgtaatcgtagaaactacagggctaaatccaagaagaaggctttcaccaagtacgccaagaagtggcaagatgaggatggaaagaagctcatcgaggctgatttcgccaagctgaagaagtactgctcttctatccgtgtgatcgctcacactcaggtaatatttatatttagtttgtttgtattcttaagttatattttgcagatgaagatccttcgccgtcgccaaaagaaggctcacctcgtcgaaatccaagtcaacggaggaaccatcgagcagaaggtcgactgggctcgcgagcatctcgagaaacaagtccaggttgataccgtcttcgctcaggatgagatgattgacaccatcggagttaccagaggtcacggattcaagggagtcaccagcagatggcacaccaagaagcttcctcgcaagacgcacaagggtctccgcaaggtcgcctgtattggagcttggcatccatctcgtgtcgccttcactgtcgctcgtgctggacaaaagggattccatcaccgtaccatcatcaacaacaagatctaccgtattggaaagtctgctctcactgaggaaggaaagaacaacggatccaccgagttcgatcttacccagaagaccatcaccccaatggttcgttttatttttttcaccgttctatgaagaaaaagtctgcaattcgtactctgtatggcgactatattttatctgagaacatcgggcgttgtaatcaattttcatgaatttttaataattgttttgttttagggaggattcccaagatacggtatcgtcaaccaggactacatcatgcttcgtggagccgttctcggaccaaagaagcgtcttatcaccctccgcaagtcgctcatcacccaaaccaagagagtcgcccacgagaagatcaacctcaagtggatcgacaccagttccaagaccggacacggtcgcttccaaaccacagccgagaagcgtgctttcatgggaaaactcaagagagatttccttgccgaggccgaagctaaggcttaaatttgtttattcaaataaattgttattgttatcaaatgtttcttcactgttcacattttgaatacactttgagtatgcttttttgttgaatctgaaggactatgctgcttg