Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F13G3.1   

sjj_F13G3.1RNAiJA:F13G3.1
PCR_productsjj_F13G3.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF13G3.1 Source_evidenceePCR731WS150 Sequence/Annotation Release
Overlaps_Gene F13G3.1 Source_evidenceePCR731WS150 Sequence/Annotation Release
Chunk_score Abs_score673
Max_abs_score673F13G3.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI72912917292238
Overlaps_transcriptF13G3.1 Source_evidenceePCR731WS150 Sequence/Annotation Release
WB_DNA_textsjj_F13G3.1948actgcccttgacgtatccactctactctcaactctttcctcacctgaaaaagaacatcgtcgtaaaagacgacgtggtgaagtagccaatccatcaaacactcttgatgctcttgttgctcgcaaagccgacgatcaaccatttgaaaagagatatctaagtgaacaagaagcaattgaaggaccagatgatgagattgaaatgaaaaaaatggaattggatcctgatgtatctacacgcacctgctctacctgtggttaccaaggaaaatgggtgtctgagatgattcgtcataagagagttcataccagtgaaagaccattcaagtgtcgttattgctccagaaccagcaagtggaaggctgaccttattcgacatgttgcaagtgagttcatattacttttctattactttaggtatttgaattcgctttaaaccttttgtaattctgtcagatttgaagtttggcagcttagaacaatttttgaaatgtaatcaattagcttctgctatacctgaaaatgtattctccaacctcaataatttcagaaactcatggaatccgtgttgtctccaaatacagccgttcgaaagtcttcgatgccaccaacagttcaatggattcttcgtgttcttcagactctgatcgatgcataatttctgaaaagagaacagtgttctatcgttgccaattgtgctcatttgaagatgaaagagtatctgtattgaacagtcatgtaagccatcttcacaacacctccccatgtgtttgtcgatgtggcgctaaatttgaagatgtccaaggagcacttgctcattccaatggtccatgctcccatgttgatatgatttacaacgttatgccaacttatgagaaaggtaaaccataattttaaatagtttaatttcatgatttaaattccttttttcagcatctccattatcccc