Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F16C3.1   

sjj_F16C3.1RNAiJA:F16C3.1
PCR_productsjj_F16C3.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF16C3.1 Source_evidenceePCR895WS150 Sequence/Annotation Release
Overlaps_Gene F16C3.1 Source_evidenceePCR895WS150 Sequence/Annotation Release
Chunk_score Abs_score769
Max_abs_score769F16C3.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1014812110149786
Overlaps_transcriptF16C3.1 Source_evidenceePCR895WS150 Sequence/Annotation Release
WB_DNA_textsjj_F16C3.11666acggttatcatttcatgggcagatacatatatgggattaccactttattcagaatctgaacttggttgcaagttcttctcatttcttgctcattttagtgattttatctgtgtttggatgatttcattgatctcttgtgatcgaatgatcgtactttatagacctagtaagtatttattactcttcaaatcaaatgtttctatttccaggaatcagaaaatgggtttgcacgaagaaattctctcgaaacatgacaattggctttgtgttatcatcagttgtcctctacagctggctatttctacttgctggtcttcaaatttatagattaaaagatggaactgaaaacacgttttgtggattgagtcaggatgtcaatttatttgggttagttaagaatttgaaaaaacaagttcaaactagatattttcaaacttttcaagaattttaagaccgcctgtttcacgtttgaatattatgtttcgacttgtagcaatactcgacgtttatcaaaaatgacaattttcaaatttttcagattccaagtggaccaacattacttcatgttcaccctcatggatacagctctttgcacacttcttccagcaattctcatcatcattgtcaactcattctccacatatcggtatcgtcaatgcatgaaaatctactcgtctggcgtgctccgtgttcgatttgtgcgtgctccaacaactcaacaacagcagcaacaactcaacaatgataccattcaatttgtaagtcttctgtttcttgtttctttcggctttttttgtttggtcggggtttctttgaaaatacaaagcaacaaggaaaaacaaagaaatatccataaaaaacaagagatgagttggataaatgatgccttcttctcactgatttattagttttctttttttattgtttttctggtttctgaagagtttgaggccaaatggaccagggagtatctcaataaaacatcggaaattgattttttttttgaaaaatgttaacaactgtaaaagatgttttgatctcgtcgaagattaacgattttgcactttttgcaaaatggaagtagttttggaatattttttaaaaattgtgaaagactttggggaaactacagaaaaagttgctttaaagaaattggcctctcaaaaatcttggcactaacaccgtactaacttaacatattttagaataaaaaaatcaaacacctgataaatattatttttcaggaagagacaacagtgaaaaaatatcttctgagcacagacaatacacattcaaatcttcccacgagttcaactcaatccagaaattgcggaaaacttcgaagttctgatttacaattgagcagaacacttatcattgtcactaggtaagatgaataagaatatcatacttttattttattatttttcagcacatttgttcttctgaatgtaccaagttatgcaatgcgtattcttcaatcaataatcagttcagctggaccattattcaattttgtatattatgttactttgctcatctattatttacatcatgctgttttattctatatgtacattttctggaggtaagtaactcttataattaaaaggtttttgaatttaaattttcagtcctcaaatgaaaaaacaactgaaaccgacgg