Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F18A1.3   

sjj_F18A1.3 RNAi JA:F18A1.3
Simmer:F18A1.3
PCR_productsjj_F18A1.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS F18A1.3b Source_evidenceePCR787WS150 Sequence/Annotation Release
F18A1.3c Source_evidenceePCR690WS150 Sequence/Annotation Release
F18A1.3d Source_evidenceePCR821WS150 Sequence/Annotation Release
Overlaps_Gene F18A1.2 Source_evidenceePCR115WS150 Sequence/Annotation Release
Chunk_score Abs_score73
Specificity_index0.097
Rel_score0.107
Map_statusBottom50_percentile_ePCRII76808207682004
F18A1.3 Source_evidenceePCR827WS150 Sequence/Annotation Release
Chunk_score Abs_score680
Max_abs_score680F18A1.3
Specificity_index0.903
Rel_score1
Map_statusBest_ePCRII76808207682004
Overlaps_transcript (6)
WB_DNA_textsjj_F18A1.31185actccgctccacccctatacgcgctcacgcacaaacccgcattcagtggccttcagcctcggagcgctctacctgcgctctcatgtgaaccaacattcttgtttgagctccttctttttcttgtattttttttaatattctgaatttcaggtgaaaaagaatttcgaacgtgtctcgctgctcacacgtctcgaagatcacccgtatcttcgtgatgatcaagatgtcgttcaagacgatacacagtctcaaggaaccgatggaatgcttcttcagctcaatgatgaggaacgacaaaggctaatgaagatgataagcacacctggaccgcagacattgagcatggaacggatacagatggctccaggacaaggtcagcatattctccaacaacatcagattccatcaacatcgtcatacacaaacgtaagtggtcacttctttgacattttaaatattttatttacagttaattttatagtgaaaactgataaaaacaagaatgataatttttagacctttaaattaaaaatataatgttttctaaaaaaataaataatataacaaaaaaataaactgtttcagaattcgtttatctacatcaaaagtgatccacaatacaaagatgaaccacaacaacaatccaatcaattcgatgccactgtgaactctgttgctcatggacaagctggactttcaacactagaaatgttcgcttgtaatggatctccgaacggtggtgatgtacttcgcagaaagacgccgtctcggaaagctgaagattcaataaaagctacgtgtaaagtatgtggacatgatgtaatgtattctcctcaaaggacttggaacttgatgcgtcacgtatggattatgcaccaatcatcaaaaccgaatcagtgttcaatatgcggatattctcacatcaagccatatgttaggaaacatatcgagtctcagcataagcatgattcaaatgcaacgataattgacttaaagtgagttttacatttctcagtttgataaaattgtcaatttgattttcagatcaccagaactagaagctgaatggagtcaattgttagatcaatgcttcggagtcacatatcgaaagtggaagcatcataaggaggatacgcagcacaccggtgggttactgttcgatgacgacgagttgagagggtgagc