Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F18A1.7   

sjj_F18A1.7 RNAi JA:F18A1.7
PF:GL1_4C4
PCR_productsjj_F18A1.7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F18A1.7 Source_evidenceePCR708WS150 Sequence/Annotation Release
Chunk_score Abs_score624
Max_abs_score624F18A1.7
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII76627917663643
Overlaps_transcript F18A1.7.2 Source_evidenceePCR708WS150 Sequence/Annotation Release
F18A1.7.1 Source_evidenceePCR708WS150 Sequence/Annotation Release
WB_DNA_textsjj_F18A1.7853ggttaattgcaaaacggcatcttttatcgattttcttactgatgacatccctgaaatgtttagttacatagcatatttaataatgatcgcactaactaacctcaatgctggtgacaattgatcaaccattacagaaacggcatcgaatggttgcataagcatgtccagactaagccatccactcaaggcacacttgctgttgagtcgcttggtgacacatgggagagtacattgcagagagttacaaagttctccaagatgatcagcaacaataaatacattacctccaactgtagcagcgaatttaatgttagaatcttgagcgaaagcagttaggtttgaacgagcatagcattctttgtcgcagcctgaaaacgattttttgatggtgggcaatttttcagaaaaaaaattacctgacatgatatcatcaacgacagggttgagacacgactccattcgctcaaacagaacgtgctttgtggcacacatatattcaacactgctgctggcttttgcgaagagcttgttgtgatcacagtactgttctttcttcagacaagtgatagcctgtgcatgatgaccacagactttgcgagcttgatgtacaacattcttcatgttccacagagacgtcgtagaattgatgaacgggtcgatgcactttcgcatgcaatatggaactccaagagcgcggaaaattgtgtcgacgtcgagggctgaagtgaaactttaatcttaagcacacaataatctagttttttaccttgttcttcgtgtggcacgacatctttgtcgtcgtgtaccgattcgatggcaccatttacacacgagaagaacagaaagatggcgg