Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F20D6.9   

sjj_F20D6.9 RNAi JA:F20D6.9
Simmer:F20D6.9:Repeat_a
Simmer:F20D6.9:Screen
PCR_productsjj_F20D6.9
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF20D6.9 Source_evidenceePCR357WS150 Sequence/Annotation Release
Overlaps_Gene F20D6.9 Source_evidenceePCR357WS150 Sequence/Annotation Release
Chunk_score Abs_score336
Max_abs_score336F20D6.9
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV81792398180098
Overlaps_transcriptF20D6.9 Source_evidenceePCR357WS150 Sequence/Annotation Release
WB_DNA_textsjj_F20D6.9860atggacgattactttttcagcaaattcaatgtattttcagaatcattatattttgtagggttatgtgcaaaaacaggaatatgtgaaaataagtagtaaaaagaatatagcttttttattttttaaaaattgtacatcttcccatcatcttccattgcagtggcagtcgcagctgcaataaattttcgtagcagaagatgagttgaagatttatgagtataaaaaatattggatgaagttttgaatacgaaagcagggaatccaatttcagatgtcgcgtagagggtggacatgtttttcgagtttaaccgaaaaatttaagctgctctttggcgtttgaagatgcaaaatttggctggaaattacaactacaaaatggagcaattaaaaatgtactcttctgttgggttcggtgtggttttggatcagaaatcctcgtggtcaattattcgtcttctcctcttattcgcctagcaaatttcaaattatcagcttcaattgtgactcttttgcattttatggcacataagtttcctagtcgaaataattcaaccaagtagtcttcgacggctgcttggagagcatctatggcgtcttttcggaatatcaagtcagtcacgaagtcttgtgccaattcctttaccaatcgttcgaatctggatcgaggaatgagcagttcagtagactgttgttgttttcggatttctcgcagagcaactgtaccagaatgaaaaggatatgatcgtactggctgagtgcacgatttgcggcatactcccgaaaggttctttttgccagccattgtttggtagatgtggtgtgaaatggagagattgtaaacccttctataggtgccaaag