Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F21D5.3   

sjj_F21D5.3RNAiJA:F21D5.3
PCR_productsjj_F21D5.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F21D5.3 Source_evidenceePCR713WS150 Sequence/Annotation Release
Chunk_score Abs_score629
Max_abs_score629F21D5.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV87332968734495
Overlaps_transcript F21D5.3.2 Source_evidenceePCR713WS150 Sequence/Annotation Release
F21D5.3.1 Source_evidenceePCR713WS150 Sequence/Annotation Release
F21D5.3.3 Source_evidenceePCR713WS150 Sequence/Annotation Release
WB_DNA_textsjj_F21D5.31200ggactccccgaggataagactacacgtaagtagagaaaaacagtaatttaaaaacaacaattcctttcagccaacctgatgcacccagaatgtacacaaaacaagaaatgtaccgttttgaactgtccattccaagaatggatggctcaaccaaacttcacatgtatctcatatgataagttggaaaatccaaatccagaaaaaatcgaggccgagattcttcaagcaacacaatttaatggaggattcgaggtgggattttgtttattatagaaatagggttggagtggcaaagcagacgtctggttttccaaaatcattggaagaaaagaatcataaaagtttattacacttgaaaaatgttaaacacctgtttttgataagcaggcgcattttcaggaaggtaagtatataatgaatgcaatgggggaaggcaaccacgagatgtctctttcctatctgtttcttaatgcctacatgcctgcctatctgacttttctaggccatcttttgttttaataatcacgagcccactttttgcaggagcattttatcaacatgcaccatgactctcaaatggatcaattcttattccaattcccatggggtattccatattatcatgatggtgacatggaaactatttcaacggtgagttagggtcgacgggagaaaatatccattttatattatttacagtcgtgcagtcaaactgcttgtgccaacaactcaatgtcagatctcgatacaacatgtcgttgtttctatcatttggagcataaattaaataatattgtgcaaataaccctttataatatgggacttggtggtgcaatgggaactggttatgctcatccattccatcttcatggacatcatttttatgtgatgaaagttggatggccatcgtataatggatctggatttattgatcaaatgaatcaagatattgattgtcctggacgagatgttagttgtaatggaaagaaatggagaaataaagattggttaggtggagcattagaagcaatgaatactaagaatccaacgaaaagagatactattacattgccagttggaggatatatcactattcggtaggtttttgttgtgtattgagcgaaagacaaggagagaagtagtttattacaagaagtgtaagaagtaatgaattataaagagaggtcgcttacgcgataa