Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F21F3.1   

sjj_F21F3.1RNAiJA:F21F3.1
PCR_productsjj_F21F3.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF21F3.1 Source_evidenceePCR906WS150 Sequence/Annotation Release
Overlaps_Gene F21F3.1 Source_evidenceePCR951WS150 Sequence/Annotation Release
Chunk_score Abs_score888
Max_abs_score888F21F3.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI49095664911805
Overlaps_transcriptF21F3.1 Source_evidenceePCR951WS150 Sequence/Annotation Release
WB_DNA_textsjj_F21F3.12240ggcaattttccaaagcttttactgataattttgaaacttacgacacactttaaacatttaaaacccctcattaaatctagactaacaccagttttctaaacataatatttttcagattggactattcaaccccagcaaagaaatcggtcaagtgagcggtttggcagtgaacaaaaatggacatatcgttgcattccatagatcaggtcgtgtttgggatgagaagagcttcaatgatcacgagacattcaataaggatttgggagtgattaataacaagaccatcgcaattatttcaagagaaaagaaagtgattgatgagttcggagcagggctcttctacatgccacatggtctgacaattgacaataatggtgattattgggtgactgatgttggaagtcatcaagtacataaaatcgatgcaaagacacaaaagatagtgatgagcttgggtgagaaaatggttcccggagaggatcaagctcatttctgcaagccaactgatgtggcagtggctaagaatggtcatatctttgtggccgatgggtactgtaacagccgtattctcaagtttgacgccaagggaaatctgatggctcagatcaatgcagctactggtaagggagaaggggagaaacatatttggaaatttttgagttttttttttccagcaaaaaaaaactgtagaacctgcacctccatttaagatagttttcgcaaatttcaaaacgttttttctgtgaaaaagtttaacacatggccgagttattttgtttttctaggccaccgttttcaacttcttcgcatttgtcgatttacgcatcttgtgtacttctctagaagaagtgtgaattttttgcgtaacggttttggcatatttatgaaaaaaattatttaatttgtaaaattttcaaattcatttcgaggtgttgactacctgcgtaaatcgacacatggccgtggccgcgtttccgtatttttttatacttttttaattttctataaggcttttctagttgctcattgagccctacgctgctttcagctcaaaatctaatcaaattagactaaaacatcccttttcgatcaagaattgctgagcaaaaccttgaaaagatctcattattctgatgcacatgtaatccattatttcaaatgaataatccaatccaaaatataaatatttctgaattgatttttgatcaaacaactcttttcagaagaaaaccaaccatctgaattcgtcgttccacactctttgtctctcattgaggatatgaatattgtctgcgttgctgacaggttagtcttcatttcttgaacttttgcgcgtaaaatttgttgtcttcaaaactgactcaatgcgtcataattggcacgtaagtttagtataaactcgttctttattctggggacgcagaaggatctcgacatggaaacgcgctccacggataattgaaaacgcaccgcccccgaaccatgggtctcgttaggtatttggtaggaaacccgttaattcaaacgggtttctttggtttcggaaattttgaagcattttcgcttttttttcaattattttattgaatcgaaatgattttaaataattttttgaacatagcattatgaattttatatcatcaatttcgacatacaaattattttaaaaaacgaaaaatttgctgccaaaaacctaacgagacccaacgtttagggacggagccaatttaatttgccatggagcgcgtttctagatcaatttcaaaagtgaataaaacgaaagaagagataactattaatttattataagtacacccattttgatgagaaaatatgcaaattttattgaaaataatatctcaaaactaattttcagagaaaaccagcgtgttcaatgcttctcagctggtctttcggagggagatcgtacacttccaacaggaattccaataacttcggccaccgacattggccgtgtgttcgcaattcgagagcgtgagcactatctgattggtgtgacgggtaacagtgaagacgttgaagcacaaatgttctcaattgatatgcaaactggaaagactgagacattcgcaaaaggagttcgtaatactcatgcacttgcaattgctgccgacggagtcatgttcgtgtcacagttggagccaagcagaattcttgagatcagacttttgtaatctaatttttgtcatcatcgttgtcgctgaaaacaaaagaagaga