Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F22B5.7   

sjj_F22B5.7 RNAi JA:F22B5.7
Simmer:F22B5.7
PCR_productsjj_F22B5.7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF22B5.7 Source_evidenceePCR738WS150 Sequence/Annotation Release
Overlaps_Gene F22B5.7 (3)
R11A5.4 Chunk_score Abs_score126
Specificity_index0.153
Rel_score0.181
Overlaps_transcriptF22B5.7 Source_evidenceePCR738WS150 Sequence/Annotation Release
WB_DNA_textsjj_F22B5.71115gtactttccaaaatgcccgacggttttgataccaacatcgaaagcaagaaatggcaggaacgaaaagaagcgcttgaaggtttgcttcaattgatcacagcgaatccgaagctcgacccaaaggcaaactatggcgcactcgttgagagattgcagaaggtatgtgtattttgtcctgaaaaattattttaaattcaaatattaaggtcctcgagaaagatgcaaatatcaatgtggctgcactagcggccaattgtataactggtattgctaatggtctccgtacgaagttccagccgtttgctgtgtctgtgactccaatcatttttgagaagttcaaagagaagaaaccaactctacgtgatccgctggttgcttgcattgatgcagttgttgcaaccacaaatctcgaagcagttggagaaatcgtactcgcagcgctcggaaaaccaaatccaagcattaagactcaaacggatcttttccttcaacgatgcttcatgaaactgaattcacagaccatgccgaagaagactttgaagacgctgatcccgtcgttgataaaacattctggtgattcggattcggaagttcgtgaagcatcatacgctgcaatgggagcaatgatgagagccattggagaaaaaccttctctgcaacttctcgccgatattgcatcggataatctgaaaatgagcaaaatcaaggagtttcatcagaaggcgttggatgaagctgggcccgcagagattgctgaaatggtcaaatcgattcacaaagcagatgtgagttattttattattattaaccagccgctgaccgcgcctacggcgcgggcaacgcctggcaccattaaaagtatttgacacacataccttcaatcactcaaaaaatttctcatcatgaaaaaaacttgaaacacttaaaacgcggtttactggcactgttacatgtatgtatttttctacgacatgcatgtttcaaaaattcacagacagtatgaaaactttctgttattttttgaccaagacagtaaccttacaataccactacagtaccttgacattatcctccaccgactcctaacccaatacctcttcaaaggacgaaatgcc