Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F22D6.10   

sjj_F22D6.10RNAiJA:F22D6.10
PCR_productsjj_F22D6.10
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF22D6.10 Source_evidenceePCR848WS150 Sequence/Annotation Release
Overlaps_Gene F22D6.10 Source_evidenceePCR848WS150 Sequence/Annotation Release
Chunk_score Abs_score785
Max_abs_score785F22D6.10
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI71053797106807
Overlaps_transcriptF22D6.10 Source_evidenceePCR848WS150 Sequence/Annotation Release
WB_DNA_textsjj_F22D6.101429cagcacttctcttcaccacgttcatgtacaatgatttgtatgatttccatagtgaagttgaagaagaattatatggattcaaggtaatttaaaagatatgtagaaacgcccaaaatagtttaatttcaggatatctacaatgatgcgtggttcttaatgaccaaaactgcttccaccaagttctcgtctacagaatcatcttctgaaatggatcgtattttcaagagaaactctgactcatgcaactgtggtgctaaagcttcaaattgtccacgtggacctccaggaccaccaggagagcctggagagaatggaactgatggacaagccgggcaggatggacaagatggtaatactccatcggaagagtatggaaattctcaggatggatcaacatctacgtgtccagcaggtcccccaggtgaacagggacctgatggtgcaccaggtgaagctggaagagatggacaaccaggtagtgacggacaatctggaaatgaaggaccaactggaccacgtggatcaccaggaaacaaaggaagagatgggaatcctggaagagacggaagtcctggaagaccaggaagggatggaactcgtggtgttggacagccaggttctccagggcaaccaggatcccgaggaccagaagggccaagaggccaaccaggaaatatgggaagacccggagaatatggagacgctggaccagctggacaacctggaaatgatggggaacagggaccggatggagtggtcggaatgtgagttaaaataaaaatgagaaacacattcaattgatgagcacatttgtgctctcacgatcaaatgctaccgccccgtcacgtcgataatgttttgcaaactcttgcaagggcggtctaggttttcatttgcgaaatttgtataattaaatgagacaattttacaaaaagtgttgattgaactttcggttattttaccgaatatgaaaattgccattttgaataaattccggtgatttctatattttttgaagaaaatgttcttttttctcattaaaataatatatttctgatatagttttatatttttatatatactatcgtcaaatcgaaaaattaaaatttttacactcatacttccataatggaaattttgaaatgaaaatatttaaaagtttttcaatttctttattattttttagaaaatctcaactaaaacttatttctttcagccctggtgagccaggtcttcctggatcagatgcttcgtattgtcaatgtccagatcgtaccccaactgtggaaaaaacgtccgcaggtggttataaagtacgccgccgtcttgtcaaacatgctaactgatgagccaactagctgtttcttttttgtttcgaatgaattttcttttttcctctttctctcttcttgtgtcccttgttgcatgt