Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F22D6.11   

sjj_F22D6.11RNAiJA:F22D6.11
PCR_productsjj_F22D6.11
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF22D6.11 Source_evidenceePCR706WS150 Sequence/Annotation Release
Overlaps_Gene F22D6.11 Source_evidenceePCR706WS150 Sequence/Annotation Release
Chunk_score Abs_score580
Max_abs_score580F22D6.11
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI71109007111958
Overlaps_transcriptF22D6.11 Source_evidenceePCR706WS150 Sequence/Annotation Release
WB_DNA_textsjj_F22D6.111059ctgtattgcagttggcgaaaattcagctccaatttttcaaaatttgctcaaagagctctcaaattgcttttcaaatattcattttatggtaagcttttcaagaatatttctaaattcaaatattctcatttcaaaattttcagaaacgaccgccgattgattggggaagccacgaaataataaattcagcatatgattgtctggaatttctgagtcacttgaaatccgattggagatattttcaatatttatcaggagttgatattccattaaagacaaatcttgaaatggttcaaatattgaaacatctgaatggaactgcaaatgtcgaaatcaaaccatatcaatatcaacgccttcgaggtaaaaatgtgagtttttgaaattagttttatattctcagtgatcattgctcaaattataatgactatttgcaattaggttttttccagaaaaagttttctttttgatttggtaatgtgccagaactgtgactgagaattgttgaaaaccccagagtttttttttaaatttaaattggcgctactccacaagctaaacaaaatttatgtaaaatcaataatccgatgaaacatcattaaaattattttcaggagactcagtctccactgccgctttttaagtcatcactgtcatcactaataccaagagaagctgccaatcacttagtgagttactgaatcaattttaaataataaaaatatcataaaatcataatttcagtcatcatcaagcattcctcaacaactattggaatttcttcgaaatactggaattgctgatgaaggattttggggaactctttttggaaacaagaacttgtttgatattcctggatctttgaatttcaaagaatggatatcatacaaaaataatgtagaaacgaacttaacatatcccactgatggatggagatattatatatccagagatcaaatatggtcaaagcccaattgtcataattacatgaaagctgggtcatgtgtttttggaattggagatgtcccaagattattgaagtcaaaagcgttggttgct