Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F22D6.12   

sjj_F22D6.12RNAiJA:F22D6.12
PCR_productsjj_F22D6.12
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F22D6.12 Source_evidenceePCR800WS150 Sequence/Annotation Release
Chunk_score Abs_score675
Max_abs_score675F22D6.12
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI71128677113979
Overlaps_transcript F22D6.12.2 Source_evidenceePCR744WS150 Sequence/Annotation Release
F22D6.12.1 Source_evidenceePCR800WS150 Sequence/Annotation Release
WB_DNA_textsjj_F22D6.121113caatccgagtcattcaccctcttttcctttttctctatgaaattaaagacattttattaatattttcttcattgagaactctcaattctgttaaaacagttttccggtattgaatactaaattccaaagaattaaatttaaatttccagatggttcgattcaaattcaaaacctcgttaattattgctatattttttttgttcatatatttttctgtggaatcattgtttccaagaaaacaagaagacaaaaatgtgtcaaaacaatttttgaagtcgatttgtacaactgcttcagattcatatttgttggataatatggagattaattgttcggtatgtaaaaaacaaatttgaaattctttgattgctgacattttcagaacattctcaaaggatataaaactaacgaaaaattggatatcatgcatttggatataattgaagaacaacttttttcttgtactaataagttagttaacaaactataaagtttaacaacaattcaatttcaacaaaaaaaacttaaatttcagatgtcaaacgctgaaaactttatttcgattcaatacaaatccaatgtcagcagaagaaaaacattttccactatcctatggaatgcttgtgtacaaggatttgccacaggtaactcctgctagaatgtttattaaacttcattttttagaaattaatttgcaggttctttttcttctctcatcaatctatcatcctcaaaacgagtactgtattgcggttggtgaaaattctgctcccatatttcaaaacttactcagagaagtctcaacttgtttttcaaatgtacattttatggtaaattccatctaagatgtaagttttgaaaatattaaattgcaaaattttcagaaacgtccaccaataagttggggaagtcatgaaataattgattcggtgtacgattgtctggaatttctgagtcacttggaaactgattggagatattttcaatacttatcaggagttgatattccattaaagacaaatctcgaaatggttcaaatattgaaacatctaaatggaacatcaaatgtcgaaattacaaattatcaacaagcacgactcaccggaaagaatg