Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F23C8.3   

sjj_F23C8.3RNAiJA:F23C8.3
PCR_productsjj_F23C8.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF23C8.3 Source_evidenceePCR346WS150 Sequence/Annotation Release
Overlaps_Gene F23C8.3 Source_evidenceePCR360WS150 Sequence/Annotation Release
Chunk_score Abs_score318
Max_abs_score318F23C8.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI24385722440211
Overlaps_transcriptF23C8.3 Source_evidenceePCR360WS150 Sequence/Annotation Release
Overlaps_pseudogeneF23C8.10 Source_evidenceePCR6WS150 Sequence/Annotation Release
WB_DNA_textsjj_F23C8.31640agaaaatttgaatgaaaaacgcaaaaagttcacgtgggggcggagcctattttcagaacatattttcggtttgctatttacagtttcaaggtctataaaaatttactttgatttgacaaattccagtttgagtacagattatcgttttatcatcaatttaacaaacagtctgactgaaaaactttctcaattgcagctttttgtatgtcacacaatttacaatattttctggaaacatatgataatggacggcaaccagtatgaagctattttcctcaactactttcgtggaattttccccaatgcagataatctgaatgtgaaatgcgtgaagcggatgagtgaacaacaagttagttttgttattaaatttcactgccacttgcaggattttggaaaaaaaacacagcttctttggggtgtgtacacattttctgtctaacttttattcaaatatgtctatcaacttaattgatttaattactttgttgggagcatcactagaactgtacctggctttccgatcagacaaatgaaaataatgaatcaatcagctgggtaacgtaaggaatgttttaaaggtgaaggtctaagtgtataaaaatagtagaacgttttttggctcgctttcaaaattacaattggaggaaactaagttagcgccactttctgactgaaaacaattattgtaaacttgtttggaaaacactatatttgataattttagaatcacatttgtacttttaaacaactccctcactgaccgtactatgtacacctttattgaaacaaatattgactttaaaccattttttgaattaaaaaaaaagtcagcgattagtctattcagcggcccctttctcacttttgaaatgatttctttgttaaaatatttttactatatagagggctagttctacaaaatttatttatagatgctaggaagaaaacaaactaaatagcaatctagtcacgctccgtaaaacgaaacgaggaaatgttatattttcagatgaaaacaaccatttcccgacatggaatgcgctgcacagtactgaatggcaaagataaaataagcagttacacggtaaagaaaatagtcgaaactcctggcaagagagaatattacggtgttcgtgatatattcgcgttcaagctgcttgacatgatgggagttggacccaaagttcattttgtttcgaatggagaagttggagacgacgttggattattcattgttacagaagatggtcagttgtcggcttgtacgaggcttctgaatccctctttatttgaaaaatagttttttatcgaactgctttgcatgtctgagtatttatcttgcatactcaaatcggtttaaatacattcaaggccaatatttacacaaatatggtaacgtttgtgcacctattgactgaacaaaatacctgaaccaatttgatatgcgacaaattttattcatatatgcaaaacagtgcgatgatctcaaaagtggtaaaataatcgtatgaaaatgagattaatgattagagacaatacgaaaaactttgtgaagagggaacaattacagctactttggaaatatttctgaatttgggacttaggacttgacaatatccgattagcccacactaaga