Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F23F1.8   

sjj_F23F1.8 RNAi JA:F23F1.8
Simmer:F23F1.8
PCR_productsjj_F23F1.8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF23F1.8a Source_evidenceePCR938WS150 Sequence/Annotation Release
Overlaps_Gene F23F1.8 Source_evidenceePCR938WS150 Sequence/Annotation Release
Chunk_score Abs_score875
Max_abs_score875F23F1.8
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII4239343430
Overlaps_transcript F23F1.8b.2 Source_evidenceePCR938WS150 Sequence/Annotation Release
F23F1.8b.1 Source_evidenceePCR938WS150 Sequence/Annotation Release
F23F1.8a Source_evidenceePCR938WS150 Sequence/Annotation Release
F23F1.8b.3 Source_evidenceePCR938WS150 Sequence/Annotation Release
WB_DNA_textsjj_F23F1.81038aagtctcttcgcgtctccaaccttgcgaacagctttcataaagtcctcgtcgataacgaattcacgctcagcacggatggcaaacattcctgaaacaaaaatgataatttgaatgcaatttttatgattcaactcctcaccagcttctgtgcacacatttcttaaatcagcagccgagaatccgtcggacaacttgacaacagcttcaaaatctatttcgccgtgtttggtgatcttgttcgagtgaatcttgagaatttccaagcgagattgttcgtttggcagtccgatttcaatctttctatcaagtcttccaggacgaagaagagcaggatccaatgtatcaggacgattcgtggccataataaccttgacttttccaagcgaatcgaatccatcgagctgattgagaagttccataagagttctctgaatttcacgatctgctgatgttccttctgagaaacgtcttccaccgatcgcatcaatttcatccatgaagacaatgcatggctgatggtcacgagcataattgaacatttctcgaatcattcttgcagactctccgatatatttatcaacaatagcagacgagacaactttcaggaaattgcaatccagttgcgatgctacagcacgagcaaggagagtttttcctgttcccggtggaccaaaaagcagacatcctttcgggggagtgataccaacacgtttaaagagttcgggattgatgagtgggagctccacaacttcacgaagctcgcgaatctgctcagcgagtcctccgacatctgaatagctaatgttaccaggatcttcgtgagacattttgtagactagcggatcaacttcacgtggcagctgacgcctgaaacatttcggtttaagactttttgtttaaaaaactaaaagcttacatgatagtaagagttgtcatatccaacgaaactcttgtcccttgcttcaactcttccttgttaatactgcgacggcatccgacaacataacgaggaccattggttgccttgacgatgaatt