Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F25B4.9   

sjj_F25B4.9 RNAi (2)
PCR_productsjj_F25B4.9
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF25B4.9 Source_evidenceePCR476WS150 Sequence/Annotation Release
Overlaps_Gene F25B4.9 Source_evidenceePCR662WS150 Sequence/Annotation Release
Chunk_score Abs_score596
Max_abs_score596F25B4.9
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV57028555703926
Overlaps_transcriptF25B4.9 Source_evidenceePCR662WS150 Sequence/Annotation Release
WB_DNA_textsjj_F25B4.91072caggtgattaccgtacccatttatgtgttctttgttttaacttttatcttttttttagaagttctcgctgatccatgcggtgattccaactggagatatttcccacaaaccaattcctgttataagctcattgagtaagtgaatatttaaattttggatgtatctcttattcgtccattttttcagtgaaaaccttccatggacaattgccgagttcaagtgcctcttccaaggtgctcatcacgtctccattgacagtccagaagagaatcaattcgttcacgaattgtctcgttggtctgagatttggactggagcagctttctttggaaaagatcagcattacgtcaactctgatggttctcgttatggaaactttgagaactggaaggacggaagaaaaccaccaatgaaccgtgctcgtcgttgcatcaagatggacggaaacggagaatggttccaatcctgctgcaagaagaagactttcaccatttgcgagaaggtttgttacacatctactaggatacatattctaaatctaacattttccagaaagccgcctactctgcaagctcctactctggatccaacaactccgtaaatggattccgtttcatgcgtcaccgctcttaaatgtgcccatcaaatgacaatttcgagcgtttcgaaaggaatgaaccagaaaaatcttcgaatgatactcatctgctaagcttttagatgcttttgctattttgcccccctgcctgcttacgtgtacaatttcttctgttgtaaattttcttgaatcataaagaaatgaataaacctacttgcaagtgtggttttgttttcaatttactcattaaactgggagtgtgtcgagtctatttggaagtgatcccttatttcttcctctttcccaatgtcatctccttctcacaatcacatacacactggcgatttccggcgatttttcttttgcgacacagtaacatcggtcgcaaggatccgcctttatcttttctgcttctctttttttcggtggtttttcctgctgattgtatgaatgaaatgaattgaatcgactgtg