Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F25H2.5   

sjj_F25H2.5 RNAi JA:F25H2.5
Simmer:F25H2.5:Screen_A
Simmer:F25H2.5:Screen_B
PCR_productsjj_F25H2.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F25H2.5 Source_evidenceePCR626WS150 Sequence/Annotation Release
Chunk_score Abs_score548
Max_abs_score548F25H2.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1055297510554040
Overlaps_transcript F25H2.5.3 Source_evidenceePCR606WS150 Sequence/Annotation Release
F25H2.5.2 Source_evidenceePCR626WS150 Sequence/Annotation Release
F25H2.5.1 Source_evidenceePCR619WS150 Sequence/Annotation Release
F25H2.5.4 Source_evidenceePCR616WS150 Sequence/Annotation Release
WB_DNA_textsjj_F25H2.51066tatgtttaatccccttccgttttcgggttgaataaaagatttgatgacagctgagtcgtgtaggattggttgccatgaaaacgcattagagaatgcgcaggaatagatgtcaacaaaaacgatgttttaggtgggaagcaatactttatcaacattcagcagagatacgaaaacggtgaaaacaccgggagacataagcaatcagtttattcgtagacccatgagttgatgaatgggctggcgtagtcgttgatctcctcctgcttgaaccagtgagcaatctcgcggttggcagagtcaacggcatcggatccgtggcagatattgcgtccggtttggatgcagaagtctccgcggatggttcctggggcggaagcgagtgggttggtagctccgagcatggaacgtccttgcttgacgacgtcaagtccttgccagaccatggcgacgactggtccagagctcatgtactcgatgagggatgggaagaatggtttgtccttgaggtcttggtagtgaacctaaaaataataatttaactggttgggcctaaaattttgtaatttcgtgaaaacgtacctcaagatgggccttggaggcggtcatctgcttgagagcaacaagcttgtatccgcgctcttcaaaacgagcgatgatctttccgacgagaccactgaaatttaaaaaattaggattttgaaaatcctaaaatccattgaggatgctagaataagtttcttcaaagataactaaccggtggactccatcaggcttgatggcgatgaaggttctctcagtgttgctcattttcggacaatccaacttggaacaggtgtcaacagcacaggcgacagcgacgaacgcaagtgaaaagaataacccgccggcgcccattcaatcaactccgacacaaatgaaacgagtgtaaccgtacttcagcacgtggcgagacccgacctcgcagcattcttggctttgtgccagaattgcaatggagcgcctttactgaccactgttttcgaccaatttttttggacaccaattgaaccttttgcgagaattatgt