Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F25H2.8   

sjj_F25H2.8 RNAi (5)
PCR_productsjj_F25H2.8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F25H2.8 Source_evidenceePCR1007WS150 Sequence/Annotation Release
Chunk_score Abs_score923
Max_abs_score923F25H2.8
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1056325810564421
Overlaps_transcript F25H2.8.2 Source_evidenceePCR926WS150 Sequence/Annotation Release
F25H2.8.1 Source_evidenceePCR1007WS150 Sequence/Annotation Release
WB_DNA_textsjj_F25H2.81164ggctcaccgaaactgaagagtcgacgaacattttgcaccaagttcatcgattggtatccgatctctgctctttctacaacctccaaatgccatgtgaattacctcaaattgctccacctgtcagggatgatatcgatgaaggtcgtggaagtgatattagtgataccacatctgaggtaatttagttttaattcagtttttcgtttttaacatcaaaaacaattttcagccaatcgacgacgacatggctggagatggagaagttgacgatgatgatgaagaggaagaagacgatgaagatgcggacggtgacatcgaaatagtagagatggctgaagaagatccaacatctcaacacgatgttggagtttcgaaagaaggtctcgatatgctcgacaaagtttcaaaaattaatagacagcagcatttggatgggaaagttcaaggttcaatcacagctacagatcgtttgatgaaagagattcgcgatattcaccgaagtgagcactttaaaaatggaatttatacgtttgaactggaaaaggaagagaatttatatcaatggtggatcaagttgcacaaagttgatgaggattcaccattgttcgaagacatgaaaaagttgaagaaggatcataaccaggatcatttgttgttcagcttcacgttcaatgagaagttcccttgtgatccaccgttcgtcagagttgttgctccacatgtgagtctctaactttgaatatttttattgaaacttatattatcctatttagatcaatcaaggattcgtattgggtggcggcgcaatatgcatggaacttctaacaaaacaaggatggtcatcagcttactctattgagagttgcattcttcaaattgctgctaccttggtaaaaggccgtgctcgaatttcgtttgacgcaaaggtaatttgaaaatttaatgtttttaaatgaaaactctaatcttatatttcagcacacatcgacgtattcaatggctcgtgctcagcaatcattcaagtccctccagcaaattcatgcgaaatctggatggtacacacctccaaaaacagaaggataactcccaattcaaagatcttcatgtcatccagtacttttttatgttccacaccctcctctcactttttcgctctccacttgg