Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F25H2.9   

sjj_F25H2.9 RNAi JA:F25H2.9
Simmer:F25H2.9:Screen_A
Simmer:F25H2.9:Screen_B
PCR_productsjj_F25H2.9
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF25H2.9 Source_evidenceePCR747WS150 Sequence/Annotation Release
Overlaps_Gene F25H2.9 (3)
Overlaps_transcriptF25H2.9 Source_evidenceePCR852WS150 Sequence/Annotation Release
WB_DNA_textsjj_F25H2.91069cgactatcccacctcttccatttttttgtgcttcaatatgtccaatgttgcttcgaatataatttatttacatttcagccagtcatgttcctcactcgcagcgagtacgatcgtggagtcaacactttttctccagaagggcgtttgttccaagtggaatacgctattgaggccgtcaaactcggatctacaagcattggaatcaagacgagcgaaggtgttcttctcgctgctgagaaaagatcgacatcgaagctgatggtcaatgacgcgatcgagaaaatcagcaaggtcgaccaacatattggttagttctgtgaactgtttatcatcttaatttataagaattgtttcaggcgtcacattcgcaggtttgattgccgactcgcgcactctggtcgaacgggcacagatcgaggctcaaaatttctggttcacttataaccgcaaaattcgcgtggaagacgtcactcagtcggtcgccaatctagctcttcagtttggagacgacgacgtcaaagcatcaatgtctcgtccatttggtgtagcaatgctgttcgctggtgtagaccaagaaggagccaaactgttccatctcgatccatctggaactttcatcgattgtaaggctaaatcgatcggtgcagctagcgatggagctgagcagaatctcaaggagcaatatcatgatgtaatttcgtcaaatatggttatacaggaaaatgtattttatttcaggctctgactatcaaggaaggactcaagatggcattggccattctcaagcaggtgatggaagagaaactgaactccgccaatgtcgaagtcgttgttatcaaaccaacagttgacgcgaaggggcgtccaatcggagaattcacaagagtgtcgaacgaagagctcgatcaagttatcacatcgctttgaagaaattattctttcctggttttttgtctcttgtttcttatggtgtaaagtaactttatttgcgatgttcagctatttcaataaattatttgtcgttcttttatacatttttgaaagcgccacacattcaatacgtccgcac