Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F25H5.2   

sjj_F25H5.2RNAiJA:F25H5.2
PCR_productsjj_F25H5.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF25H5.2 Source_evidenceePCR699WS150 Sequence/Annotation Release
Overlaps_Gene F25H5.2 Source_evidenceePCR699WS150 Sequence/Annotation Release
Chunk_score Abs_score615
Max_abs_score615F25H5.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI91798789181505
Overlaps_transcriptF25H5.2 Source_evidenceePCR699WS150 Sequence/Annotation Release
WB_DNA_textsjj_F25H5.21628ggtgcaccctatcacacctataaataagggtttcaaatggaaaaaaacacgattcaatataaaaaataatttattcgagacaaaagttacagagctgcttgagagattgacatgagatccgagtttatattatccgactgcatttgctgcaaaaaaatatttttagaaacttttttcaaataggcgcgcgaaaaaaaatcaaaaagcttacactcttcgactgatgactgatgacaggagcttctttaatcacttcataatcacaatccggtacagtttccagaataatcttcttatcagtgaacttgcaaacgagtaaagccaaaatgagaatgacagattgagcagctgctgctccgatgaacataaatggccacattccttgtccaattcttgtttctcttggtttttcatctttcacaagcaattctttcggagcaattttatcgaaggctaagtgcaacggatgaacatatccaaaattgccgctaacgtgaccaggactggaagaattatatactttaagcaaatatattcttaatccataatgttcccgtgcattttggaaacacatacttgtcgtatagccctggccaggtgcccagactgtgttcttgtggttaggctacttttagctacttctaggcttcaagtcagaaagaaagtttgaaatttcaatttcaaagttcattgcagtggagatatagtcaactatttacctgttcttgtctgatccagaaacaattcggccaagagaatgcctatacggtgtttgaggattacaacataaagtggcattagtgtctgtgccgggaagtttgatatgaagtgtttgacatcctgtacaacagactctttcttctggaaagtcatccgttggatcagccacaaaatgtggttgatcaaatgacattgcgactccatatttgcaaggggcaaatgttggctggtgtttatggactgaaaataaattatagatttaaaattattgaaaacttcataagaactcacccaaataagtcatttttacttttgtatagacgttgtcaaatgttttgtcctcacaaagcgcccagtatggcaaaccaacgagaagaatgatattcaaagaaatcatattgaatccgttacttatcacttctttgaaagggaataatgttttgttttttctgatatggtgagtatttgaatagatatttttgagttcacgccgaaagcagtcggatagaaataatttaaggtaaaaaaggcttgaattcggaccgaacgtcggaaattacgacaatgcaaataattttcacttcccggattctacagcacgaatgaatgtgccgagaaggatcgtgggcggcaattgccgttcgccaaattttttagtcgacaaattcggcaaatcggtaaattgccggtttgccgatttcccagaaatttttaattccggcaaacttccgatttgccgtttgctggatagcagatttgccgaaaatgtctagagagattttttataaaacgtaaacacttaaaatcgttttgaaacttttttttccgattttctctcttttcaaaatatatttatagacgcaggaacattcatacgaagcgtacaactttgccgattgtaattgaaa