Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F25H5.6   

sjj_F25H5.6 RNAi JA:F25H5.6
Simmer:F25H5.6:Screen_A
Simmer:F25H5.6:Screen_B
PCR_productsjj_F25H5.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F25H5.5 Source_evidenceePCR70WS150 Sequence/Annotation Release
Chunk_score Abs_score70
Specificity_index0.092
Rel_score0.101
F25H5.6 Source_evidenceePCR714WS150 Sequence/Annotation Release
Chunk_score Abs_score693
Max_abs_score693F25H5.6
Specificity_index0.908
Rel_score1
Map_statusUnique_ePCRI91589339160040
Overlaps_transcript F25H5.6.2 Source_evidenceePCR508WS150 Sequence/Annotation Release
F25H5.6.1 Source_evidenceePCR714WS150 Sequence/Annotation Release
F25H5.5 Source_evidenceePCR70WS150 Sequence/Annotation Release
WB_DNA_textsjj_F25H5.61108catgaagaggagcagaagaaaaaattggcgaagaaaagaaagtgaaattttggcattacatatataagttcgattttttaagtaaaagtaaaaataaattcatttctataaactagataatagattgatgctaaaaatttaaaaacaaataaagtcaacaattgaaaatactccggaacttaattcttcttcatactgggactattctgcaagtgtaggaacttagtcttcaacttctgaattcgttgattttgctcgacttgtctttttcttagagctctccagtacaaccatccatccttttcggcatccaaatcttctaaatctcttggtgctcgaagatccaatttgaacagccattcaggatactccgagtctggaagaattttcggtcccggctcatctccttgtgtgtatgcattgatgcatacgtgggttgccaatttgacagcatcttcttcgacgaaagatttgtcgacttttacacctgcagcagctgctgcagcttttggtggagcatataagcgtcgaggtatcagtgatgtagttcgactgactgttgaaagagtcgaacggagcatctgaaattttgaaactagaactcttgaaatcgcacatactcaaagcaagataatattgcgttcaactatgtacaagcaaaatatctttaaatgtgataatttcatttttcgggtcgaacttttctttaaaaaagcggaaaaaagctcaaccatgaactgcctccattttactttaattaattttttaaaagatttactttatttgcttttcgaataattgtttttactataaatagaaaaactgcaattttagaatgtgacattctagaattttttgaagttattataaaaatttgctagctccatcgagaaatatattgaaatttttctccggcacacttgatcgacataatacatgcacattagatacgaaaaagtattcaaacttcttttaaaaacaattttaaaatcttataaaatacaagatctttttgtttaaaaataacacaaccagtcataaaatagagaaataaaatccacagataagtgagaacaaaatacagatatgtcagaggttttgaggggta