Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F26B1.5   

sjj_F26B1.5RNAiJA:F26B1.5
PCR_productsjj_F26B1.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS F26B1.5a Source_evidenceePCR803WS150 Sequence/Annotation Release
F26B1.5b Source_evidenceePCR582WS150 Sequence/Annotation Release
Overlaps_Gene F26B1.5 Source_evidenceePCR803WS150 Sequence/Annotation Release
Chunk_score Abs_score666
Max_abs_score666F26B1.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI63094856310590
Overlaps_transcript F26B1.5a Source_evidenceePCR803WS150 Sequence/Annotation Release
F26B1.5b Source_evidenceePCR582WS150 Sequence/Annotation Release
WB_DNA_textsjj_F26B1.51106cttgctacaatctctccgccagttacaattgttggtgatatccatggacaatatccggatcttgtgagaattttgaattctcggatttctaaagaagaagctaaacaaaaaatagtcaccagttattcgtcaaacaggtaatattaattgaatcgaaacaaattatttttccaaagaaattatttgaagatttgttttcctgggcgactatgttgatcgaggaaatcattcaattgaatgtatttgtctagtttttgctttgaaggttctcgatctgaaatttgtttcccttttagttattatgtttcagatagcgtatcccacaaatttcgttttgctacgtgggaatcatgaaaccaaagcaatcaattttgcgtatggatttagagaagaactagagaatagacttggaaaaaaggatggtttcgaaatttgggaaaaattcaacgaagtgttctcttttatgccattggcttgtttagttggtggacgaatcttgtgcatgcacggaggaattagtgaaaaattggagtcattggattctattgatagcgtatgtttgacattttacgggaatgcgaattacactcacctgcctcttccccattcctccggaattttgcgaaaattataaatcgttcacaacataatagtttttagatcgtacgcccacttccggaagttaccgatttggctcaagatttattgtggtctgatccaatggatgtacaaaccttggcatcgatcagtgagtgagttgcattctgttaattggagtttggaatacttatagacaaaacttacttttagtacaccaaagtatgccaagaacattgtccgtggattagcacattccttcaatgatgcagcagtacgagatgtttgccgacgtctaaatcttcatttagttgttcgagcccatcaggtattccaaataacgatattgatttttcatgacacattctagatgattcccgaaggattcaaattcaactcggaccgcaagcttctcactattttctcggcgccacgttacatgaatgagagtgatgtgagttttttttcaagaattgtttttttatttttatttttcagaaccgtggtgc