Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F26B1.7   

sjj_F26B1.7 RNAi JA:F26B1.7
Simmer:F26B1.7:Screen_A
Simmer:F26B1.7:Screen_B
PCR_productsjj_F26B1.7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF26B1.7 Source_evidenceePCR571WS150 Sequence/Annotation Release
Overlaps_Gene F26B1.7 Source_evidenceePCR571WS150 Sequence/Annotation Release
Chunk_score Abs_score488
Max_abs_score488F26B1.7
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI63223986323567
Overlaps_transcriptF26B1.7 Source_evidenceePCR571WS150 Sequence/Annotation Release
WB_DNA_textsjj_F26B1.71170taatcctcatcaattgaaccacctaccttaacgcgcggttcatttgagaaaccaataaataaatcttcatgtactacctctcctgtctcaatgtttgtctattagtgacacatgttcacagattgtcacattaatcttcctcttttgatcatttgtcctatacaattcaactgtcacacgtgactctttcactcaccgctccaccgattcccatctcattgctcgcagtgactcccggaaaatgagttctctttctggccttgtatccacgtggacgacgacggaatccgttttcctccaacatgaactcacatgaatcactgattgtccacttatgacccttacgaccacgataactgagaagattgtatgagtttagttgtgtgaagtatttcatcagactaacctctctccagtatcttttggcaacttaacgaagcattcgtttaagctcaaattgtggcgaatagagttccgccatccagcgtattctccacgaaaaaattcaaagttttcctgaagataactgtaaatttcagccaatgttgcctttttgtccggacgcttctgaaatttagattgactttacaaaaggaatacacagtttttaaaattatacttatactttaaaacataacatgtttggcttttaagatgctcttcccttaaaactttgcacaaacttcagattttacaatcttactacgataaatcatttctttgattttctgaatccgagattttacttaattcaaataattaagaacaaatgttgtcagtaaaatgactaactaaaatatagaaaaattaagtgataccttaaaaatgcgttcttgagggaaaactcactgaaatagccatagcaatcaaagcaatataagaaaatggtggtttctcttttctttttcttgatctacatccttgtccatcactgtcttcttttgaatcttccgaatcttcatgcgagttctcattgtaatcttcctcatcctcattaaagtagttttcagctttaattgtacgatgcgaattgtttggagcagtactatccaatttcagtggacccagagcattggcaagagaataaattgctgttgagctgaaatggtttatcttttgatgcactaaaagtataacaaaagtcttaagttcctcattgtcgtttcagaa