Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F26E4.1   

sjj_F26E4.1 RNAi JA:F26E4.1
Simmer:F26E4.1:Screen_A
Simmer:F26E4.1:Screen_B
PCR_productsjj_F26E4.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF26E4.1 Source_evidenceePCR747WS150 Sequence/Annotation Release
Overlaps_Gene F26E4.1 Source_evidenceePCR747WS150 Sequence/Annotation Release
Chunk_score Abs_score621
Max_abs_score621F26E4.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI97552569756443
Overlaps_transcriptF26E4.1 Source_evidenceePCR747WS150 Sequence/Annotation Release
WB_DNA_textsjj_F26E4.11188tcgtgccaatggagttgatagttgaagcaagtccgagacgagtttacggaaatgctcacacttatcacgtcaacagtatttcagtgaattctgatcaggtattttaataatttttttttgtgttcagcttttttcaatccaaagtatacgatgaatcaaaatctcaacagtataaccttcttcacatgttcggcgtatttttttaactattcaatttattagaaaaatagtaccaggttggctgaattcttttttgtgaaaatttaaaatgtttggtactgcaaggaccaaaatatcaattatgtataagtgaaccgaaattaaaaattatattccgattttcaggaaacattcctatctgccgacgatttgcgagttaacctttggaatctggagattaccaatgagtctttcagtgagttttgaatacttgttttcaaaaaattttaatatcgatttcttccagacattgtcgacatcaagcctgctaatatggaagaacttacggaagttattactgccgccgaattccatccaacgcagtgtaattggtttgtatactcttcatcaaaaggatctattcgattgtgtgatatgagagatcgtgctctatgtgatgcgtatgctaaaagtgcgtttggttctgtgtattgattatataaataatattaatttgcagttttcgaggaaccagaagaccctcaatctcgatctttcttctcggagattattgcatctgttagtgacgtcaaattctcacataatggaaggtacttgcttacgagggactatcttactgtcaaggtaattattaataattaaaaagaaaatttgaacaacttttatatttcaggtgtgggatttgaacatggaatcacaaccggtagagacatatccagtgcacaattatttacgaacaaaactctgtgcactctacgaaaatgattcaattttcgataaattcgagtgcgattggagtggagatgacaagtaattaattgcagtactttttcatattataattttctttttgcagacatattctcacgggttcgtatcataatctgttccgttcatatgctcgtggcaataaccaagatgcgaaaacttgggaagctcggcctcaagaaccacattcacagctccgatctcgatttgttgtaccatcagcgaaacggaagagaaaca