Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: sjj_F26E4.8_b   

sjj_F26E4.8_bSequenceATTCAGCCGGAATTGTCAAC
PCR_productsjj_F26E4.8