Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F26F2.1   

sjj_F26F2.1RNAiJA:F26F2.1
PCR_productsjj_F26F2.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF26F2.1 Source_evidenceePCR759WS150 Sequence/Annotation Release
Overlaps_Gene F26F2.1 Source_evidenceePCR759WS150 Sequence/Annotation Release
Chunk_score Abs_score652
Max_abs_score652F26F2.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV2055730220558465
Overlaps_transcriptF26F2.1 Source_evidenceePCR759WS150 Sequence/Annotation Release
WB_DNA_textsjj_F26F2.11164tcgattgttttccatcattctctgagtattcacaatgatcaattaaaaaatttcattagactcactttcatttgattaaatccgtctatatttctgatttcctgttgttccaacgacaatcgtaagtgattagggtctttatcttctggtccattgtaggaatgagtctaaaaattgagtggtgtgtgtgttaaagtataaaaccttaattcctacttttctattgtcgacgaaatgatcatcaaattgctgattatgaatctggctattgttggtttgacggcgctgaagatgaagttcatcagcccttgaagtattgtgagaatttccgcgatatggcccatttcctctattgccaactctcgtttggtgatcttcgcggtgtctctgacctggttccatgtacatcttaaaatttaagttataggtgtattcatcggatagttcttaccctctgctgatcatccgaccaatcttctcgattctctgcataccgttgcactccttgatcaaacacccctctgggattctgaaaatttaggttttgcattttctcctacctcgaatggggtattctctagatttaatatttattatcatagaaagctgacactttattttataaagctatatgtgaatcaaaatgcgttttaccccattttcctcatagtaagctttgcttattgcatgtcttagtcgaactgactctgacgagtatctcttttaccagcattataaacttgtttcgatcttaccatggagacatttttgtaattcggctcaaggcttgttcgatcattttcgtgaaatccgtgacctctcggctcttcatgagtttctagttccctgggctcaacgaatccgtggacgttttgataacttgatgcgcccatccgttcttgtgccactctgggatttgcaaaattttgctctcgctttttctcaaatctcatttgttcgttttctcttgatgctcgattctgttcgatgtgacgctggaattataatgtattcacagtaaaataaaaaatttgttacctcgtctccccttagtctccgctcttcttgctgactgtcaaaactatttcgtcgctgatgaaaatctccatttaccgtcatacgaggatcattgtagttttcttgattttgacaagccttatcgtt