Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F27C1.1   

sjj_F27C1.1RNAiJA:F27C1.1
PCR_productsjj_F27C1.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF27C1.1 Source_evidenceePCR790WS150 Sequence/Annotation Release
Overlaps_Gene F27C1.1 Source_evidenceePCR790WS150 Sequence/Annotation Release
Chunk_score Abs_score727
Max_abs_score727F27C1.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI54345435435735
Overlaps_transcriptF27C1.1 Source_evidenceePCR790WS150 Sequence/Annotation Release
WB_DNA_textsjj_F27C1.11193aaaaatgttttctgctgtttccaaaagttccatcattaacaccatataaaaaagaacagaaaatcttgaaaaattctttttttttcgagaatttcactgaaagctgacgaaaaaaattcggaatatttttgcgatttagacgtgacatcaagaacttatagttttaactttaatcaaaacaatttgcacgtaactcgaaaggttaacttttctagtacatcaagataaaggacactatataacaaggagaaatctctgatttctttcattacgacattactcgtcctcactaacaagctaactctactaacaaaatggtcaagaagatcactgtctacacggcttttggacaatttctcaagatggtcgaactgcaaatggagcaggaaatggagaaaatgaatgagattgagactgataaacttccgattgatcatcaattgagtgactatcagaataacatcgaatcggtaacttttgatttttccgggctaacagaaagctttgtttctcagggaaatgatcgtcaagttcaatcatgcccagttgatgtgtctattccaaaagaagtcatgaagtgtgcaagctgtcctttgctatgcttcaattgctcagttcaaatgcctgtctcacccgttccaacaacaatcgaatcccgtaagatcaacgagactactcaattgatgatggaattttggaagattgttgcttcaaagtctgaagaggaaaagctcccatcactattcgaaaatgttgagggactgttttctgtcccattttcaacttttggaacgtgggatgatgacaccctgtctggtgtcacatcgcttaattttgaaaagtctgatgaacaactctccgagcaagatgatgacaaaaccactgtttggagttctaatttcccatcggctcatgttttaacagtctatgagaattctgaacagaagacggatgaaatggccgatgatggtaagaaccttttaatgactatctcgaatgaaccattctttcagaaatgtcggacacaacttcatcttttctttctactctttccacaacaatgagtgctcaagtgccggcgcttcatcttcttcagagagttcaattgcaaagatcagttatcaagaagcagaaaaagattattgacagtttcagtgaacttcagaatcttaacaagaagctggctgatcttc