Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F27C1.11   

sjj_F27C1.11RNAiJA:F27C1.11
PCR_productsjj_F27C1.11
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF27C1.11 Source_evidenceePCR879WS150 Sequence/Annotation Release
Overlaps_Gene F27C1.11 Source_evidenceePCR879WS150 Sequence/Annotation Release
Chunk_score Abs_score795
Max_abs_score795F27C1.11
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI54400885441269
Overlaps_transcriptF27C1.11 Source_evidenceePCR879WS150 Sequence/Annotation Release
WB_DNA_textsjj_F27C1.111182ggagctttcactcgcaaaactacgagccgaaccagctgtagattttcttgatgtagaagttggcaaccttgtatcaggtgtatggattgccggtgtttctctcaaactttcgtcgtcatcgtcatcaacttcctcatttccagagtcctcttcatctattgtgccattcatcatatcatgtttttcatcttcatcttcatcatctgaaacttcacgaacagctgtagaggatgttgtcggtcgggatgaatatcgcgagtgaggttctgatgatccagatgtgctgagacgagaagcttcggtagctgctgttgtttgacgggatggcgtctgaaagtgttctttattaatctccttcgcatcttttagctcaaaagtcatactaaaacatacagcttgataaggagtatcctgtcggctcatagttttccgccgttgtttctgattcatttttgatttagataaacttggtaatctgtcagattctgaagtagatggtgttttctgtgctggagttctatgacttgaatgagctgatcgtttctttgcactttcagctgcacttgttgcatttgatgttgctgcttcttcttcttcttcatcgcttgttccgctttggatcccagttgctacaatgtttagatttttttcattttgaaatgtcttaattttcaaaggtgtagtggcgttaatggggatcggctttgaaatcctcaaaataatcggaaactcggacacgccacaaaaaagaaaagagaaaagtttgaattccctctaaaatgagaactgcaagaccaaccagcgattcgcaaaaaactaaccatcatgttcaaaatcactttctgcttctcgaattaaatcctcttccgaatattgatccgaactactattttgatgattttgttgttttaaatttgtacgtaattcttcacgaatcatttgagcttttctgaaaactgatttataaaactgaaaatccagaacattaaaaactcacttttctgtcattttttcatgtctctcagattgttggctattattcaaagaagttccttttccagaatctttggttttattactttctgcacttgacattgcagtatccttttttggctttttattaacttctttagaagttgtcttattgttcaatttggtagtaggaggaaccgtttgtttcaa