Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F27C1.2   

sjj_F27C1.2 RNAi Simmer:F27C1.2:Screen_A
Simmer:F27C1.2:Screen_B
PCR_productsjj_F27C1.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF27C1.2b Source_evidenceePCR747WS150 Sequence/Annotation Release
Overlaps_Gene F27C1.2 Source_evidenceePCR750WS150 Sequence/Annotation Release
Chunk_score Abs_score645
Max_abs_score645F27C1.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI54299485431134
Overlaps_transcript F27C1.2a.1 Source_evidenceePCR744WS150 Sequence/Annotation Release
F27C1.2a.2 Source_evidenceePCR738WS150 Sequence/Annotation Release
F27C1.2b Source_evidenceePCR750WS150 Sequence/Annotation Release
WB_DNA_textsjj_F27C1.21187tcagtagagcgcatttggtgctgcaatttttagacaattttttttgtggagttttcttgtttgcaaactttccatctcgataaaatgcatgttcatgacaggttgcgtataaaaggtcgcaaaatgttgaagctgcagttgaaattgttatcttgtataacttctagtcatattaaacgcaatttttattgattttcatgttacgtcatatattttcagatcatgggtacacaattggccatcctaggatggttggctgtggctttggtggttgctgctgcagaaaataaggtttaattttaatagttgcttcaaaaatctaacatttagcatttcagagtgcttacgcacaagctgcagacaactttctcgatgagctcgctggaaaagaagtagaagcggttcctgtgcccgatgaaaaagatcaaaatgaacatcatgaacattcgtctcatggatcacacgcaggtcatggtggacacgagggacatatgatgaaaatgtggttccatggaggatttgaagaagttattctattcgatttttggaggacggattcacttttcggtaagattttcattattcaattcaagtttatttcttaactgttagttaattttaacaactcttcaggtatgcttttatcgtgtgctgctattttcattatgggcgccacatatgaaggtgtcaagtggttccgtgtatttctgcaaatgacgcaaacacaagctcaggttcttgccaacaaatcatgcgtggaggtaagtaattttatatttctctatgtttcattaaaaaatatcttatccgacctagtttgcacttcagacaacgcggtcttctggaggcacttgccatcaatcggttacccactcacagagcaacaagcctcaatctgaaccgttcctgatatcggcttcggtagcgaggacccctgcaacttcgccattctctcctcaacggctcattcagatgctcttgtacatttttcaattggtgctcgcctattggctcatgctcattgtgatgacttacaacacttatctaagtaagtacaaatttctagttttaaatcaataattctgtgtattttttcagctgctgcggtggtattaggagcaggatttggacattggctgtttgcagttctccaactccgaaattgtgatggagaagtgacggattcg