Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F28B12.3   

sjj_F28B12.3 RNAi JA:F28B12.3
Simmer:F28B12.3
PF:GL1_5G8
PCR_productsjj_F28B12.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F28B12.3 Source_evidenceePCR969WS150 Sequence/Annotation Release
Chunk_score Abs_score906
Max_abs_score906F28B12.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII59225565923726
Overlaps_transcript F28B12.3.1 Source_evidenceePCR969WS150 Sequence/Annotation Release
F28B12.3.2 Source_evidenceePCR969WS150 Sequence/Annotation Release
WB_DNA_textsjj_F28B12.31171gctcatcgcactacgaacaacgtcgacaagcctgataagaaacgagctcacaatggaacatgcatcttcacctcaactgacgcacatcgtggtaacaatccatcattccgtggtgatattgagattcttgcctataatctgatgatgtgggcaactggcacattgccatggatggtgagttaatactttttcgaacgttattatttttgaatgggttacaggctctcgaatcgtcccccgagaaggtttttgatgccaaacagaagttcattgctggattgccaggcaccttgcagaatgtacttaaggttcgtacttaacgtcttccaccccattacacgctattccgtgttatacctaactctacatgctctgaagccaaattatggggtcagaaaacttcaaaagtggatatatttgtatacacacgcaaccaacctaccaattacacaattattttcagaacgaatcatctgccgtcgttggttgtattgcatcaatgttcgatatatcgatgaaaaccaactacactgacaaagttgatatgggaaagctgaagaaattggtgacagacgctattcagaaaacttcaagtgatggtaaaaagacgccaacgagacagaagaaactcgccgaagaagataaaaatgcagtgacaccaaaaagaagtacccggagattagctgtgaaagaagagagtgacaataaagataatgatgaagtggaagttaaaccggaaaagaaagctactcccagaaagagaactactcgaaaagctgtggaagtcaacaatgattcagatgacaatgaagaacaatatgaaaatccaaaatcaaagtcatcgagaactcaaacaaaatccaagagagcaaaggaagaggatgtcgacgatgaagaggaaatcatcattccgaagtcgtcaagatctcgaagtaaagtacaattatctggagaaggatcagatgtcacgacgccgtcttcagctgcatctacttcgagaagtcgcagtattcgtctaggattaacgtcatcaactgcttcttctaataaagttgccaaaaaaatcgagcaaaagtacaagcgtttgtctatgaacaaatcttctctcgttcccgtaacaatttctgttgcatccgataaatctccaacaacctcaactccttcgagttcg