Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: sjj_F28D1.10_f   

sjj_F28D1.10_fSequenceTCATGCCCGATCATTATTCA
PCR_productsjj_F28D1.10