Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F28G4.5   

sjj_F28G4.5RNAiJA:F28G4.5
PCR_productsjj_F28G4.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF28G4.5 Source_evidenceePCR829WS150 Sequence/Annotation Release
Overlaps_Gene F28G4.5 Source_evidenceePCR829WS150 Sequence/Annotation Release
Chunk_score Abs_score724
Max_abs_score724F28G4.5
Specificity_index0.759
Rel_score1
Map_statusUnique_ePCRV1629215216293294
C31A11.5 Chunk_score Abs_score111
Specificity_index0.116
Rel_score0.153
C31A11.1 Chunk_score Abs_score119
Specificity_index0.125
Rel_score0.164
Overlaps_transcriptF28G4.5 Source_evidenceePCR829WS150 Sequence/Annotation Release
WB_DNA_textsjj_F28G4.51143ccacggccatgactaaaaataccaacaatctatagttaccagtaaatgaaaatttgggaaattgcacaaaacgtagagttctcaacaggtccatgtgctacaggtcctaacacaatttaacatttcaacatctccaaattttcagacttttccttttcagaacgccaactgcgactcatctgttttctcttaaagcagtttgcatgccatactcctgcagtgaaaaagatcttccaacagtctataatcaaatctccaatcaaccattcacggcttgtaaggcatattgctcaagttacccggtagagaaaactcccgcattttggggattcacttcttttatggcagtgatgtttggtatagctcttttggcaacagttattgattatttgaaagatgcgctgaaacaagaggatcagaagaggagtgacagtagaattcttcaaattctattaacattctcattatggactaatgcagagctgctattgagtgtgaaagagcaaaaacctggatttataaaatgtttggattgtattcgatttgtttcaatgctgtgggttgttgcagggcacacgtttacttatttgatgcctcctggtgagttttcaataaagttaatttttatttcaaatggaacagttgaaacatatgtagtatcatttcaattccgcattcgttctaatagttcagtggggaaaagtatgtttggacaattgtcataatcagaaatttattgtaagcaagctcgatttcagatcaactactatcagtcctccccttcactggtaaattctggaatcatgtcattatgaacgccttcttctctgtggacacattcttcttattatcagggctcgtagtttcatatctcttttttaaaactaaattaaaagtatctcaaatcaaaagtccaatcacatggattctattctacgtgcatagatatctccggctgactcctccaattatgatatttattggatttttcacagtttatggtttttatattcaaggccctggagttgcgtcacagatgtgtaagacttctgaaatataacgttttttttttcatactgacaactacgtagttcagataaagaaaacggtgaggtggaagtctgcgagaagaactggtggaag