Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F28H1.4   

sjj_F28H1.4RNAiJA:F28H1.4
PCR_productsjj_F28H1.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS F28H1.4a Source_evidenceePCR753WS150 Sequence/Annotation Release
F28H1.4b Source_evidenceePCR573WS150 Sequence/Annotation Release
Overlaps_Gene F28H1.4 Source_evidenceePCR753WS150 Sequence/Annotation Release
Chunk_score Abs_score627
Max_abs_score627F28H1.4
Specificity_index0.631
Rel_score1
Map_statusUnique_ePCRI39740013976738
F47B3.3 Chunk_score Abs_score366
Specificity_index0.369
Rel_score0.584
Overlaps_transcript F28H1.4a Source_evidenceePCR753WS150 Sequence/Annotation Release
F28H1.4b Source_evidenceePCR753WS150 Sequence/Annotation Release
WB_DNA_textsjj_F28H1.42738attaatgcacctccaggaaaaattaaagccgtcacctacttgttttttcagtttaaattgttttccaaaattatatttattgttcaaaaaacggatggaatgtgttgcaatacaaaagagtggaaaattcaaacaaaattgttgcgcctctgttgttgttgaatgacgactggattggatccgcctgtcgcacgttcattgtttttccatgagaggaacttaagataacaatcgaatccgtaggcacacatggctccgaacgcgaaaaactgaaaaaaaaagtttagctgatattcagagatgagtttgggagtttgggtttaaatgtttttgtagcttccagaaaaaacctgtttgaagctggaaagataaaatatataacttttgtatttatcaaacctgtggttttcgaaaaatcggtaaccttatcggtaacttctcaattcaaatttttggtgcttctatataaactccactgatttgatattaaaaaagttaaagcaaatgtaggtatattcttatcttcatattttacaactacccacggaacattttcgaatatttagagtaccaataaaatgaaactcaccgcagcaatagcccaagcaaatgtaccgcggaattgagaagaagcgacggcaagaacacaggcggcgataaagaagaaaacagtccatgcgaagcagtacaccatttcctggaaaattatgatttctgttcttgttgaaagctgagaaaaaaagattttctttaaaatctatctattgcctcaaatgatgtggaagcaacttttaagtatcatgaaaaataaatccctatcttggttcattatgtaaactcacacaaacaatccagttgatggaaggaagagtatccacaactcggaaaaggtaaagagtaagaagagaggtggtcacaaagattccaactgatgacacaaatgtagcccagccgacgcctgaattagaacttacatatcgttctgtaaaatatatattacctgtataataagcaggtcccatcatgacaaaaatgaaggtgagaagacataaaacaatgcagacgatcttcatgattccacccaatgttctgatgtattcacagtcgaggcgagggaactcgatctagaaaattgtcggtttttttcgaacttcagccttttttgcaattttttctataaatgtttcagttaaacaaaggttcgaagctcaaatcttggttattttaaaagttgccaaaagttttcattttcaaaaatatcagccatgttacaagtaggttgagttgggtgaaaaagatcttgcgaattagagggtgatacgtacatgtaagggtttggctaaagacaaattgttccatgtttttgaaaaatgaattataatacaaatccccaaaaaaaccgaaaattaggcggaaggaaggaatttgaatttgcggcgcaaaaattcccgccaattattttgctagatttttttaatgtattgaaacgtatttttcttaatacattttgcaacttgttatctcgcttaataggcagcatttttttttgaaattttgcatgccaaatattgatgttctgcaattcaaccaaatttaaagcctagagtttaaacttaccctaacagcaggcccatcattcccaatatattccgtcgtttctacaactgttgtagttgtctgatacctcggtgaatcatacattttctcctttttctgctccttttttgactttgattcttcgttctgaaatttgtgcatatagaaaaatgtatagaaaaacatataactttttaagtttaagtgaattattctcgcaatcaactgttcaaaaaagtgaaacctttaacatgtgtaaagttggaatgtaaacatgattagaatttttaattgaattcaaattaacatgttgatgaaacaaaacttcaattattaaattttcagcatacgaacaaagttctgtgtctcacttcaaaattcttgaaactctagaagatctaaaaaaaaaagaaaaaaaaatacacccaacagtatatttccgcgaacaaaaaaaaacattatgagtcacttactttaacaatattccttactacaggaaattatgaacaacaaaaactaaacaaaaacaaaaacaatgcaaaaaaacgcgtgaaaagaagaagaaatgaagcagccgcccccactatctgtgagcttggggctcttctgctccaaattttacaccgggaggcgttaagagaggtgatcagtttgggagagatgaaagaaaaaaagaaacgatcgaaggacacatgttgaaattcttgcggaaggacctggaggaggggatagggagagagcatagttaaaggaaaaaagatggaaatagaaaatggctcaagggataggactagtcacagttgattcgcgatgtgtgcatgatgcctcagtgagcacaattaccccaccgcgaatgatgcgcgtcacgaaaccgaccaatcgcgatcaagggtgtattttttcgattttataaaaaatcaaaaaaccgacacccttgttcggaccgctcatcgcatattaactagtgcagttatccttcaatttgaatgttgttttatttttacctgaagaatgtgcgttggatccagcgcaacgattgcagatttctgaattggcggaggcaatggaggaggacttggagcctctatcggaggttcttcctgctccaaagcttctggatggaggatgactctatgattcgt