Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F30A10.7   

sjj_F30A10.7RNAiJA:F30A10.7
PCR_productsjj_F30A10.7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS F30A10.7 Source_evidenceePCR1069WS150 Sequence/Annotation Release
K02F6.1 Source_evidenceePCR1069WS150 Sequence/Annotation Release
Overlaps_Gene F30A10.7 Source_evidenceePCR1069WS150 Sequence/Annotation Release
Chunk_score Abs_score832
Specificity_index0.443
Rel_score0.794
Map_statusBest_ePCRI94980479499115
K02F6.1 Source_evidenceePCR1069WS150 Sequence/Annotation Release
Chunk_score Abs_score1048
Max_abs_score1048K02F6.1
Specificity_index0.557
Rel_score1
Map_statusBest_ePCRII25542762555344
Overlaps_transcript F30A10.7 Source_evidenceePCR1069WS150 Sequence/Annotation Release
K02F6.1 Source_evidenceePCR1069WS150 Sequence/Annotation Release
WB_DNA_text sjj_F30A10.7_11069attccttcacgaagtggtgggctcggcacaagctcacatttaccgaagatggagctgagctctcaaatcgcgaaagaaatcgcatgttggtagctcgtctcgaggaatcgacgtttcaacgatttgtagattcacaacgtgatgttgaggatatctatagcgttcctgtcgaagacactatcaaagctcttagcaagtctttcggttctcagcgtagtctgatgattagacgccagagttgtctccttatcagtcgagcctctggagcgtctatggatccgctcgagtatacgaacctcgttggtgaggcagttctcgatgcaaaactctcgaatatgtcgacagatgattggtcgatctttatcttcttacgtggaatggatgcgccggaggacgccctagcaaagcgttatttgatgcaatattacgaacagtttgagagaaaagatgaaaaactcaagttatccgacgtccatgacgaatggatccgttacatccaaacgcagcagcaatccaaagtcatcacagtaactcccgccagacatccgaaattcgaagtaaaccaagttgatgcagatgacaagaagaaggattcgagaaaaggaaactacagacctccgtattgttacaagtgtaaagtagtcgggcacgtttcaaaagactgtcctcagagttccaccaattcaggtgtgaccaatcgtaagactgagcattctgaagtgaatacgctcgaggttgggtctggaagacagacatcgcctagtctccggttgaacgtggaaggacaacagatcgatttcacttttgatacaggcagtgacatcacccttatcagtgtccagaactggcaaaagatcgggaaaccgcatctcgaaaaggtccaccacaaaatttgctgtgccaatggtactgaaatcgctgtcaaaggtagagtgctcgtatggttcaaagtcaaaggtgtcgaatacactgagtatgtgtacgtctggaacagaaacaataatctgctaggcaccagttggatgcgccactcgcctcaaatgcgtgatgctctggccgtaatggttaa
sjj_F30A10.7_21069attccttcacgaagtggtgggctcggcacaagctcacatttaccgaagatggagctgagctctcaaatcgcgaaagaaatcgcatgttggtagcttgcctcgaggaatcgacgtttcaacgatttgtagattcacaacgtgatgttgaggatatctatagcgttcctttcgaagacactatcaaagctcttagcaagtctttcggttctcagcgtagtctgatgattagacggcagagttgtctccttatcagtcgagcctctggagcgtctatggatccgctcgagtatacgaacctcgttggtgaggcagttctcgatgcgaaactctcgaatatgtcgacagatgattggtcgatctttatcttcttacgtggaatggatgcgccggaggacgccctagcaaagcgttatttgatgcaatattgcgaacagtttgagcggaaagatgaaaaactcaagttatccgacgtccatgacgaatggatccgttacatccaaacgcagcagcaatccaaagtcatcacagcaactcccgccagacatccgaaattcgaagtaaaccaagttgatgcagatgacaagaagaaggattcgagaaaaggaaactacagatctccgtattgttacaagtgtaaagtagtcgggcacgtttcaaaagactgtcctcagagttccaccaattcaggtgtgaccaatcgtaagactgagcattctgaagtgaatacgctcgaggttgggtctggaagacagacatcgcctagtcttcggttgaacgtggaaggacaacagatcgatttcacttttgatacaggcagtgacatcacccttatcagtgtccagaactggcaaaagatcgggaaaccgcatctcgaaaaggtccaccacaaaatttgctgtgccaatggtactgaaatcgctgtcaaaggtagagtgctcgtatggttcaaagtcaaaggtgtcgaatacactgagtatgtgtacgtctggaacagaaacaataatctgttaggcaccagttggatgcgccactcgcctcaaatgcgtgatgctctggccgtaatggttaa