Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F30F8.3   

sjj_F30F8.3 RNAi JA:F30F8.3
PF:GL1_3B8
PCR_productsjj_F30F8.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF30F8.3 Source_evidenceePCR738WS150 Sequence/Annotation Release
Overlaps_Gene F30F8.3 Source_evidenceePCR985WS150 Sequence/Annotation Release
Chunk_score Abs_score880
Max_abs_score880F30F8.3
Specificity_index0.866
Rel_score1
Map_statusBest_ePCRI78356357837321
F30F8.9 Source_evidenceePCR178WS150 Sequence/Annotation Release
Chunk_score Abs_score137
Specificity_index0.134
Rel_score0.155
Map_statusBottom50_percentile_ePCRI78356357837321
Overlaps_transcript (5)
WB_DNA_textsjj_F30F8.31687ataaactttgcgcgtcgaatctggcgcttgcgtacatgtttctcgtctctagcttttcctttcatcttctcaccaattttacaacttatcgactttgtttcgagtcttgtgttgtttaaacatttaaaaaactctaaaaacatgtttttttgtttaatatatgttatttcagagtttctgcttttatggatcacatcgacgctcatagtgcggtttccacgagttcgagctcttcaaaatatgatacgccggatgacaatatttctgaacagcgactattgtgtgacgcaaaagtaattatttgattctccattgaagaacaaccataatattcgttactacaggaagaatatccactgaatgattatcttttcgatgggatcaatcaagaatccgcacaacggagccttcttctatgtcgtcaaacatttgaaacttcctttggctttgctctccaatcatatgtattcaaaagaacatcttcaaacagttacgaaagaataacttatgtggattacgtgtcggctgatagcccagctgatcgctgcgggataacacgaggtattcaatcatttaattcagcttttcctgccaactactgcaattttaggcgacatggtcattgctgtcaatgaaaaaagcgtcgtcactgcctcccatgcagaaatcgtcgaatcaattgctcagtgtcttcaagtcagtctcgttctggtcttcaaagatgtagcaagaatcgtggaattgagcatgcggtcgattcagttacgattcatgctcgatgcaaaaattagagaattgaggatgctcgaaaagacggaagaagatttgcaagcattatatgacgatgaacgtaagtcgagtttacggttattattttgattatttgtaacaattttagatggcaatgaggaggaagacgaatcacttgaaagcacgctttacgaacttgatgaggagctaaaaaatgtacaaaatccacaagaaaaggaagcaaacggcactgattatcgccatctcattcgcatcaacagtagcacgtctgttggaactccccaagtcacgcgtctctagtaaaatcaatgtctttcatattttcacgtttatctctgaacactcatgggtaaacatgtatactctaattatatatttcgatccctggtacatagttgtacatatatgtattttaacttcctgtctccgcccaaaatttgccattttattcccattccagtcattttgattcccacaaacctgtgatcatggttatgattctagcctgcctgttatactattagtttcaggaaataacatgaagttttatctactattcctgacacaattatttcaattatccatgaggttctgtgccttttctactttttcgtttgtttttccttgacaaaactactttttttcaaacagatgcactcattgtcaaggattcttcttcatcgcagtaacagtgtgctcaattcgcctacttttcttgttgctgttaggtagaccttttcatcattaaaacctgttttattctgagtatccgttaaattcaatattatccctctaaaaaatgtgttctacttcagacaaacatcagccggtccacctccagccactccagctaaagaaggatccttgacctacaagtatgaacaatttattggaaaatggcctaaagtgttggcac