Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F30F8.8   

sjj_F30F8.8 RNAi (8)
PCR_productsjj_F30F8.8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F30F8.8 Source_evidenceePCR786WS150 Sequence/Annotation Release
Chunk_score Abs_score723
Max_abs_score723F30F8.8
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI78519917853184
Overlaps_transcript F30F8.8.3 Source_evidenceePCR786WS150 Sequence/Annotation Release
F30F8.8.1 Source_evidenceePCR786WS150 Sequence/Annotation Release
F30F8.8.2 Source_evidenceePCR786WS150 Sequence/Annotation Release
WB_DNA_textsjj_F30F8.81194tgcaatggatccgatgaataagatgaagaagcttcgtgatatggaatttcttgataaaatcgatattgaaactgcggataacgtgcaatcacaaatgtttgatttacaaggatcaacgacaagtgtgaggtatacaggccacggtggtcccgtgttttctgtcaatttttcaccggatcgacgacttcttatatcatctgccggagatcgaacagttcgactttggagtatggagactcagaggaatgctgttatttatagaacaccagcagtagtttggcaggtttgtatttatataattttaactagcattttaactgagatatttagtgtcgttggtaatcttatttcaaataatagatcattatccgaaattatcgaatttaactaataaaaaaactgtctcataaagtttcagcgcaacgttctacattatctaatctgaaaactattacaggctcaattctgtagtcgtggatactatttcgctacagcaagtgccgataaaacagctgcaatgtggtcgacagatcgaatgcatccacttagaatattcgctgatccatatggagacgttggatgtattgattatcatccaaattgtaattatattgctggaggatcagatgatagatatgttcgagtatgggatgtttgttctggtactcgagttcgcatttttagtggtcataaagcttcgattatcgctgtcaagttctccccatgtggtcggtatatcgtctcgttagatgctattggaaatctgatgatttgggatttggcataccagagattagttgcagctgaaattacggaacaagctggaacgaaggtagtgaaatataaaaatgataatatcatattactagttcatttcagggttcaattacattctctcgtgatggtggtgtatttgcggtatcccatggaaattcaagtattcaattatattcacttgatactcttattggaacagttctcgccgctggacaaaatgattcctacattgagccaaagtaagttttaattaggaacaaaatacttggagaaatatacaggtacaaatattatgaaaacgcagaaaaatccccttacgagaaagaagaaagtataaattttattcatcaaattagccataacatttttttaaaccacttaaaaacaggacaaatgcttgaagatcggagaaatcgg