Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F32A5.7   

sjj_F32A5.7 RNAi JA:F32A5.7
Simmer:F32A5.7:Repeat_a
Simmer:F32A5.7:Repeat_b
Simmer:F32A5.7:Screen
PCR_productsjj_F32A5.7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS F32A5.1a Source_evidenceePCR34WS150 Sequence/Annotation Release
F32A5.7 Source_evidenceePCR372WS150 Sequence/Annotation Release
Overlaps_Gene F32A5.1 Source_evidenceePCR289WS150 Sequence/Annotation Release
Chunk_score Abs_score150
Specificity_index0.263
Rel_score0.356
Map_statusBottom50_percentile_ePCRII72521237253074
F32A5.7 Source_evidenceePCR589WS150 Sequence/Annotation Release
Chunk_score Abs_score421
Max_abs_score421F32A5.7
Specificity_index0.737
Rel_score1
Map_statusBest_ePCRII72521237253074
Overlaps_transcript F32A5.1a Source_evidenceePCR289WS150 Sequence/Annotation Release
F32A5.7 Source_evidenceePCR589WS150 Sequence/Annotation Release
WB_DNA_textsjj_F32A5.7952taaaagagtgggaggacagatgaaagatcttaagatattgttgaagtataattcaatttattgtaataaaatttcaaaacatgtgaaacaacccgacttggggaagatcagaagagacggaggaaggtttggtttttgggtaaaaaaataatttcaaatacataaattatttagagtaaacgagaaattgttatcagcaatcgaagcactgcaggaattatcgagctcctccgcgtccgcctcggtttccaccacctccgcggtgtcctccacgtcctcctcgtccaccaccacgaccacgggattgctcgcgctgctgttgacgacgaacttcgttgacttcagttttcacgagatcgaccacctggaagaatgggaaatgttatgttgtcgaagagaaaatcaggtacttactgtttctggaattctgagatacttgatagtagatccccggacatacgcttctgacattttgaagaacttgtcaccgtcctgtaatttaacatgtattgttagtcgcaaatttgcatcaatccgagagttttagatgtttgaaatattgagctgacatatgaatgcaaattaaatatgaaaggttctttctaaattagaatctgtgagccgtttaaaacaaaattatgttttttttcaataataacgaaaagaaatttctgaatagccagtttctcctgggctaaccatttaattaaacgaaacacttacttttgatgtgaaaataacatccaccaaatgaatattcatccacgaatcgcaggctttcaggtgaccgttataagtctcgccgttcttcaactccacaagcatcgggtggttttgagcggttttgagaagagaaagtggcaactgaaatcatacactatttgagttcagcttaattcgacttaccaccatgactatattgatttagtggggttgtgattgtttttcacta