Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F32A7.3   

sjj_F32A7.3RNAiJA:F32A7.3
PCR_productsjj_F32A7.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS F32A7.3a Source_evidenceePCR803WS150 Sequence/Annotation Release
F32A7.3b Source_evidenceePCR803WS150 Sequence/Annotation Release
Overlaps_Gene F32A7.3 Source_evidenceePCR803WS150 Sequence/Annotation Release
Chunk_score Abs_score677
Max_abs_score677F32A7.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1483007314831728
Overlaps_transcript F32A7.3a Source_evidenceePCR803WS150 Sequence/Annotation Release
F32A7.3b Source_evidenceePCR803WS150 Sequence/Annotation Release
WB_DNA_textsjj_F32A7.31656tgcttctccttgagctcctcgaactatccttgtttgaggaacacagtcgagtgatgatacacgcggagagcacaacaattgcagccatactcacggctaacacaatacacatgaccgccttctctttgttttctgaaatctaggatgattttctgagaattatttgaaactcatacctttaaagaactgaacaacttgaagaagatcgtgcccaacacccactaggtttggttccactctttccgttattggaggaggatcttgcttttccattcgatactcgtcatgggttacataggaagctacaaattgaaagttatataatatcagtttagtgaaaaaaagcgataccatcgttagcaatttgatgtacatcgggatccttagccggctcactatccaccactctttcccactgtgtcttatcattgacatccttgaaaaatcgttcgtcatcctgtttttgcattgcgtcggcttcctgaaaattattttgagaaacagttttcaaaaacagcgtgccctctattaatatggcacttctgttagttttgcccatctaacagagttgcgccatcttttttaaaaaaagtattgtatgatttaatgatagaggaaatactattactgaagcgtatgctgttaaattttaatcgaaaatgttaattaaccggacggaccttcaaataagtttccaatgaggtcagctcgcctttgatggcctcctctgagaatatctcctcgttaactgaaaatattctacattatccttaaacttgatctgttttattaccacaaacataaacgacatgaagatgcccatgtctgcaatgaccttttatgccatcactttttagtgtgcacccttccttggcgtggcattgacgaagtacttgaggtaagacgtctgagacgcattctgaaatttttttgattaaatagtaaacgataattctatttttccttccacactatagtttttcaaaaaattcgatacaatgagagtcttgacatctttcccattttccgtcaattcgtaccaaacggaaatcctactttagtattcacccttctcgtgtgttcctcctccaccaccatcccatttcattttgaacccaaagccccggatcttcagaagacaattgtcagagtgttttctggctacgtctcttgctaaccagtactatcttacttttagctcatcgggaggctcaatggaatggatagaagaagaagatgaggctaattggatgtgtgtcatcaactcacaatgggaagaatgagaacaattgcgaaacagtgaaagtatcagaaaagaggaaatagagaaaaggtgaagcacctcaagctctgcattttatcagaaagcataatttgtttaattggtctttgtggttctgtttgacaaaatatctttaaaaacttttcaacttaccatgtctaatttcggtttcgggatcacattgaggcgatgtcttcatttgtgcggaatacacagccaaccgtctaccttccctacactctaaacgaatctctggacgaggtggatcagtgggctttggagtacaaaatgtttcctcatcgaaagacattggaatgcaaccatatgccatctgaagatattttgaagttgttgggcacggatcatcttcaaat