Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F32A7.6   

sjj_F32A7.6 RNAi (3)
PCR_productsjj_F32A7.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF32A7.6 Source_evidenceePCR624WS150 Sequence/Annotation Release
Overlaps_Gene F32A7.5 Source_evidenceePCR119WS150 Sequence/Annotation Release
Chunk_score Abs_score98
Specificity_index0.131
Rel_score0.15
Map_statusBottom50_percentile_ePCRI1484999014851132
F32A7.6 Source_evidenceePCR694WS150 Sequence/Annotation Release
Chunk_score Abs_score652
Max_abs_score652F32A7.6
Specificity_index0.869
Rel_score1
Map_statusBest_ePCRI1484999014851132
Overlaps_transcript F32A7.5a Source_evidenceePCR119WS150 Sequence/Annotation Release
F32A7.5c Source_evidenceePCR118WS150 Sequence/Annotation Release
F32A7.5b Source_evidenceePCR119WS150 Sequence/Annotation Release
F32A7.6 Source_evidenceePCR694WS150 Sequence/Annotation Release
WB_DNA_textsjj_F32A7.61143ccccaatcctgatcttttgaccccgccgaatgctcttcaaaatcactatttttaatgtttcaattatttattgtatatttattggcagtattttgctaaattcagtcttttaaatacagtgttttagcagtcgtttatgacattgttcccaccactttgaacattttcatctcaactctgaaatccacgtcatcctcttcacttgtcacatgcaacttccagataccacgtgaattctctccaaaaaagttgacggatacaaagttccagtcgagaagatctcgcgatgtgtctttgggacgaagtggaagcagttcggagattgtgccccgtggcgattccaatctgatttgaacttgtcctcgatgtggatggatgatagatccggagacaattacacgttctacttttgtgacgtcacaatccgaattatcgattattccattcgctagattcattttctcgcaagtcacttgaggtgccacattctcccacgtggcagccattaccacgagtttctgtgcattcagtagaccgaatccaacttttgggtggaaatttaggccagcagaattttcatacaattccacgtcacggattgcacttgcattggaggtgcgagcaatgaggtgttgaatgtcacgttgggatagtgtgggactgaaattattttgaactataaattaaagttaaagaaaatactcgtatgaatcatgggtgggcggcaattgccgttcggcaaatttttttgtcgacaaattcgaaaaattgtcggtttgctgatttgccgtttgctggatatcagccggaaatgtttagaagggttttttagagacggaaacacttaaaattgtgcctttttggaaattttttccaagcaggttcgcagactcaatttggaggaaaactaaattctttcgatttctttcgtttttttttgttgtgggatttctgaatttgaaacaattttgaattttttgaagcaaaatcttcatttacgctactccacatttaaataatttggaaaaaaaacaaacttagcatccaataccaatgaaatgattcctgatgcaattgccgcagaagccgacgatccggatattgaggaacacgtggattctaggccagtggtttgctgaaaat