Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F32B6.10   

sjj_F32B6.10RNAiJA:F32B6.10
PCR_productsjj_F32B6.10
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF32B6.10 Source_evidenceePCR875WS150 Sequence/Annotation Release
Overlaps_Gene F32B6.10 Source_evidenceePCR875WS150 Sequence/Annotation Release
Chunk_score Abs_score770
Max_abs_score770F32B6.10
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV98883519889785
Overlaps_transcriptF32B6.10 Source_evidenceePCR875WS150 Sequence/Annotation Release
WB_DNA_textsjj_F32B6.101435aaggctctacactcaagcagatgctcgaaaaatctctccatcgtttttggcattttcatcagagccacacccatattcattttttgtcgtgcgagaatcatatgatctttcactccatgccatggaagacgatcattcaaatcaaccaatgtgaacagaagtgaccatagatcatcttttcggccaagtttgtatcccagatgagcatttgaagatgtaaagttcagagatccacggaattgcaccttggtacgaagtgggcgagcatagaaggctttttcctggatataaatcatggatctgtaggaagaggctagcgccgacagccgaaaaaatcagccagccgcacaacccttgtgcctacttgtgcgattgtctgtttacgtgtctaacaacctacgtacctacctgcttacctcctctacgcgcctacctgtctagcaagaagatgccagataaactgagaaaatacggtaaatatcacaactattttaagtcaaaattatcaaaaaaatatcgaaaactcactttcgaccatgcccattgtcttgttaatccaaaatcaataacatgcacaatgcggctcctttttctatcatcggctgctcccatcaataggttttccggttttatatctcgatgaatgaaacctttttcatgcatcaatttcagggcatataaaatctgaatcaaggttaaatagattttaaacttcatttaatgatacctgaataccaagtcgactccaagttcctcgcagaaaacgccgatctggacatttcagcttcaaatctctcaagttttcaccaagaagtgtcataacgaaaaaatctgtaaatcaaagaatgcactccaatggaaatttgagttttaaattactcagatctttctgttttgaaaaaaagacacattttggaatgtgcggtagttcatttggataactgagaagtctcataactgtcacttcgtgatcgataaaatccattgaggtaaggcgaacttctatttttacagcgtaatactgatcaaatggaagactccgaccgacgaagattttagcaaatgtgccttctccaatttggtgtgtaatcatccagtcaccaagcctacaagaatatataatgtactatgtcagttggatggtcaaaaaatattttgataaggacaattttttgaacagacagaatccaattgagaagcgagcttccaaatgatattattgggtagtatgactgttgtgtgaaatgaagaaacttacatcattggagcaataacaatttccccaatttccatgactttctcacattgtccattattgtcatattttatcacttctttacctacaccctcaacgttcttgagttcatcactttttttggagataacttctttctttggctcattgtcattatttttaattgcttcttctttcccc