Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F32D1.2   

sjj_F32D1.2 RNAi JA:F32D1.2
Simmer:F32D1.2
PCR_productsjj_F32D1.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F32D1.1 Source_evidenceePCR6WS150 Sequence/Annotation Release
F32D1.2 Source_evidenceePCR291WS150 Sequence/Annotation Release
Chunk_score Abs_score249
Max_abs_score249F32D1.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV43458594346768
Overlaps_transcript F32D1.1 Source_evidenceePCR6WS150 Sequence/Annotation Release
F32D1.2.1 Source_evidenceePCR291WS150 Sequence/Annotation Release
F32D1.2.2 Source_evidenceePCR289WS150 Sequence/Annotation Release
WB_DNA_textsjj_F32D1.2910tcaaaaagactggggtaacttgaacaacttaaaggcaaaggaataattgagcttaaaatttatatcgtctaataaaataaatcataaacaatcggaagtgagagaagaaaggtatggaatgtatccaaatggaattattcgaatactgttgtgcgatcatttgtctacttttgctgctttccattttcccatgtggtgatctgaaaaattcgtgttaaaacttgaataataaggcgtatttaatcaccttgagagttgcctctggcttcttaacagcggcctttcctccgacttgcttggtgcacttgcgggtgatctcggcagcgatttgcgagtaacgcacgtagttgagtccagcggctctccaggcgaccattttctgaaaaacatgaataaaaaagaaatattggaaaaaagcgactaattttgcacaagaaaacaaagaaaaaccgcaattttactaatgaaatctatcgattttagcaattagaaaagctattttacaatttgcgattaaaaaacattaatttcatctaaaaacagccaaaaatcaatgaaaaatcacaattctactcttgaaacaaaaaatgtgtcgtttctgcagcaatttatcgattttcgaaattataaaagctattttacaatttgcgattaaaatgtacattaatcccatctaaaaactaacaaaaaaccaagaaaaaccacaattttactgatgagacaaaaaaaaacattttttctcagaattgcctgtcgtttctgcagcaatttatcgattttagcaattattttaccaattttaattaaaataaacattaattccatctaaaaacaaccaaaaatcaatgaaaaaacgaacaattttctttaaaaacagctaaaaatggcacagtccatgtcggaaaaatat