Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F32H5.1   

sjj_F32H5.1 RNAi JA:F32H5.1
Simmer:F32H5.1
PCR_productsjj_F32H5.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF32H5.1 Source_evidenceePCR745WS150 Sequence/Annotation Release
Overlaps_Gene F32H5.1 Source_evidenceePCR745WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRV1335882313360249
Overlaps_transcriptF32H5.1 Source_evidenceePCR745WS150 Sequence/Annotation Release
WB_DNA_textsjj_F32H5.11427gccaaaacttgatgctcgatattgacctcgttcactccacgcaaaaatctaacaaatcctgaaaaagagacctcctctagttttgaaatgatcgtaagaaatcataccattctctccaaaatctgtaccccattggtgaacgcaaagccaatatggtactccattgtcaactccccatccaataatttttgtgtccattccaccttcttgatctccggctgtatgcacatagattccagttttataatcccaaaaatcgtcataaataatgaaagacgcaatgacggggccatttgtcatgatttcaatttgaatgtctgtcatcttttttccaacattgtaatgtgcttttccaaaatgtttatcttgtttatatgcaatcggccaggttatgttagaagtacaatgctcctcacatgtcggagtatggtaaccagggcacggcacagatgttgtaccatttgcatatttcttatcacatggataaatagaatacggtttacatccaaattgatcattgtaattgccaccagtacagagaccatgggtttgccaccacttcagaatatcttttggccaactaccgtcacatctaaaattaaaaatgtatgtaggtttttttaaatttaaattttttattaagcaccgaatggcactgccattttaataaatcgtcgtttgaaacaagtaccaaaaaattatgggaaagtatagtgttcagtaagcgattaccctaatctatggctttcattttctgttaatcttgcagactctgtcagtctggttttcaagataatgaaaatttagttttcggatctaacgcaggaaagacaaaaatattaaagaattctatttccaacaactttttatttcaacctacccccatccatctccacaaatagacatcaaaccaacacaacatgaaagtggatcttgtgcagacagtggccaattgaatgtaccatttgaggcaatacaagtgcgatcagacgcaatttcaactgcgaccaggtgagccgctgaacctgaaaacaatcaaagttcgtctatcatcttgttcgtcacgtttctcctagaccttccttgttgagtactttgtcacgttgtcttttcgtatttttagcccgtgtgactcatgttatttttgttctatgttttgaaactagcgataaaatattttaaacagtttttctgtgtctcaacaaaattaaaaaatagagacaaaaatgatagatcgacaacagagtgagtatccctctgcttcttttcaaatagtacttctccgaaatcacgtcactctctgaccgaccagtcttttcgccaaaaaaagatatttaggcaactgttaacatatcaatttctctacttaccacaatcggattgatcacgaacggctccaatttgagaacacgaaggccatttctgac