Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F33A8.5   

sjj_F33A8.5 RNAi JA:F33A8.5
Simmer:F33A8.5
PCR_productsjj_F33A8.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F33A8.5 Source_evidenceePCR552WS150 Sequence/Annotation Release
Chunk_score Abs_score489
Max_abs_score489F33A8.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII1104911311050044
Overlaps_transcript F33A8.5.2 Source_evidenceePCR549WS150 Sequence/Annotation Release
F33A8.5.1 Source_evidenceePCR552WS150 Sequence/Annotation Release
WB_DNA_textsjj_F33A8.5932aactcggaactaaatcttgaggccgggggaaatttcgcagtaacagagaagcggggaagatgaacaggcggaacacggattatgaaagcttttcaacttctcaatactgatttagagggagaagactagttcaaaggccttggtgattccgacgtcgttggtgttgaagtggaggagtgcgccgagcagaagaccagtgatgaggtagactccgacgtgagcggcctttgcagcagcctctccgatcacgtatggacgagcgtaatcgtacacgactccgtggattcccctgaaaaattttgatttttttgttgttaataatatttacaattaatttatgatttttttttcgaaattttccatctttttcagtaaataatatgtgaaatcgatttaattcccttaccaatgaatatggagagtgagggcaacagtgagaacggcatccataactggtccgtggatgaagtaggatgctggaagaattgggagcattccaacggcccaaagacgttcaagctgtaattatttatgattatcctctgcttttaagccttaaaattcccaccttaaagtgcatagagtggtctggaactttgctggctccatcgtttaaagtagaggtggctctaacgattgttgagattcttggagcgcttctggcgacgagaagtgccttctggaagtgagccatatgacggagagacgcggccatcctggaattattgatttttggagcaaaaacatgaaaaatctgtttcaaattaaatatttcattaatcaaatttgaaaattttaataaattcgctactttctgaatagagaacacacaaaaacaagagagaaggagggacaaaatcaattcggcggttcgtacaacactccgaaataacgattacgcgtgttgtttagcgaatatcaatgcgattttt