Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F33E2.2   

sjj_F33E2.2RNAiJA:F33E2.2
PCR_productsjj_F33E2.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS F33E2.2a Source_evidenceePCR890WS150 Sequence/Annotation Release
F33E2.2b Source_evidenceePCR890WS150 Sequence/Annotation Release
F33E2.2c Source_evidenceePCR890WS150 Sequence/Annotation Release
Overlaps_Gene F33E2.2 Source_evidenceePCR890WS150 Sequence/Annotation Release
Chunk_score Abs_score827
Max_abs_score827F33E2.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1256953912570631
Overlaps_transcript F33E2.2b Source_evidenceePCR890WS150 Sequence/Annotation Release
F33E2.2c Source_evidenceePCR890WS150 Sequence/Annotation Release
F33E2.2a Source_evidenceePCR890WS150 Sequence/Annotation Release
WB_DNA_textsjj_F33E2.21093tgtatttcctcctccatcgcaaatgcgcttttcggtccaccatgatccctggttactgtagacggatactgtatacatttcgcgaactctctgtaagaatcccatgccaactgccactcctcttcagtcatttcgaaaagttccggcttgaagatctcccagtgttgtcggatgtgggagaatgagggacgattgcgacctttttgagatagacattgcttgatgagaagtacaagacctttcggagcttcttctggcattggaaggctcagaatgctgaaaattaaaaggtttttaggattattaaaatggttttctggacatttggctatttgaatcttcagaaaaaaaaacagaaaatcagggaacaaactacaactcactttgttccaacaccaaaaatgattgccatctgagcaatatttgcgtatggcgtctctctggtgagcatctcccagagcacaactccaaatgagtagacgtcgactttttcgttgcatggctgtttttttatcatttctggggccatccagctgaaaatgttgaagttcattacaaccaagcttaggtctaagattaagcccaagccaaatttaagaaccctaagcctaagccaagttccaacttacctaacagttccacagaatgacatcatagtactatccattttcttttgcatatgagacgttccaaaatcacaaattttaattgaatcttcagcggagattagaatattgggcgatttgagatccctgtggatcactttgttctgatgcaaatagtgcattccatcagcaatttccttaacccattgagcaaaaagttctcgggttattgtatttcttgacttcaatacagtacatagttgtccttttgagcaatattccatcactatacagtagcacgggctctttgagcaaactccgagaaattcaatgatattctggtgacggagatgtcgaagatgcttgatctcggtctccttcagttgattgacctttttcacagcgacagttcggttttccagctgaccacgaaacactgctccctggctcccggagcccagccattcaagttcggagatagcgtcgaa