Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F35E8.9   

sjj_F35E8.9RNAiJA:F35E8.9
PCR_productsjj_F35E8.9
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF35E8.9 Source_evidenceePCR747WS150 Sequence/Annotation Release
Overlaps_Gene F35E8.9 Source_evidenceePCR747WS150 Sequence/Annotation Release
Chunk_score Abs_score663
Max_abs_score663F35E8.9
Specificity_index0.911
Rel_score1
Map_statusUnique_ePCRV1591886515920402
F35E8.13 Chunk_score Abs_score65
Specificity_index0.089
Rel_score0.098
Overlaps_transcriptF35E8.9 Source_evidenceePCR747WS150 Sequence/Annotation Release
WB_DNA_textsjj_F35E8.91538cgtcgttgatgatatggtcgtcagcccgttgtgttatgtcttgaagagaatgagactagcagattctgcaagtggaggcgcagtatgatcttctttgcgcgagggtgtagaaggtgttggtgcagaatccgttcagagaccaggctctgcatgcagtgctcgagtcggcgatgtatgaggagcaggtcaaggaagatgaagaaagagtagttgttgacgaggcacatctattgcaagttctctgacagttggcgttcacgaaagtctgaaggccgatggcattgcaaatggtgatgtcattggagcagtcaggaacggcatccacacatcctccttggttgcagaatccgcaggcagatgggcagtccgtggctatgattgttctccaggctggggagatgcattgagaggcggtgatcgaggcacagttgagacgggggtctgaagattacgcgatacagtaaaatatgggccgctcatgtctcctcagcattataagccaaatttctattacatgacacttaatcactacagaggttcaaaagaatgggtagcatctaggctcaactgtcgtttgaagttgtttaacattatttactagagcggtcagatctggtttagaggaatatcagttccttgagcgccatgctgttggagctttcactgggctgatattccagattgatccacatctcaattgagcatgggtgaacctataaggggagaatggacttgaacttctgattttatgactgctatcggccaccacgacatactgaactatttccacaccaatcttgatgtttctaggcgaatatttgcgccagaaaaatacctcaatttgttagaatgtcttttcaactcacaggcaacatttgggcaactgtaagcactagtttgacaacataatccgcaagttcttgggcatgtgctctgagctgcagtcttcatgtcttgaactacagcagctggagtagccgtagcagtagtataacaagccaatggtctctgctggtccctgcctggtgatgggtatccatcagctggaactgggtttgggtacaaaactgcgcaggatgaatcggagatcacattgctgcatgcagtggcggctgtagtccagacaaactgaaaatcatggaatacaattaacactaaagtaagagatcagcgtaacttacagcagttccattgtaggttgtgcagttaagatctcctccgataacagcgctagcctgtggagccaggaatgcaagaatgaacgaaaccagagcaatcattgttctacaggcttagttgagcttctccgagtgactaagacgagagccgaaaagtaaagcttctgtgatttggcttcttattttatagtaatccgggtagctttgcacaactgcttctattaaattccttttatacaatgtagccatttttgttgaacctatttgaacagattaaccgatcataaatctgtttcaaaatttcaaaaagagctggtacaatttcagaggcctggatattctgcaacttcctaagccagg