Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F35G12.10   

sjj_F35G12.10 RNAi Simmer:F35G12.10
PF:GL1_3B1
PCR_productsjj_F35G12.10
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF35G12.10 Source_evidenceePCR885WS150 Sequence/Annotation Release
Overlaps_Gene F35G12.10 Source_evidenceePCR885WS150 Sequence/Annotation Release
Chunk_score Abs_score780
Max_abs_score780F35G12.10
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII45946494595792
Overlaps_transcriptF35G12.10 Source_evidenceePCR885WS150 Sequence/Annotation Release
WB_DNA_textsjj_F35G12.101144ttgttgaatggcgttttgaaggaatttttcctggaagtctttctgggagacttgcttctcgacactgtcattgatcaacttcagcaattggtcgcgctcaaatctggcctttgtctcctcggtctctttcaaatactcgatgcgacgcttgatctcattggaaatggtttgaacattctttctgaaaaataattttaaaatacagaataaaaaggagattaggagattatattcaagtaacaaaattcgcggtttttttttcaaaaaaactgcgatagagcgcgttttattgtttagctcacctataagcggcctccagctgtagctgcatggaatccttgagagaagttggcatgccttccttgagagcagcaaatgaagcggtttgagcggcagaggttttgcggaaatcaacagcttccttcaaatcttcttgaataagtcctttgaagaaaccaacgcgttcctgatagtccttgtaaagaccagcatcgattttatctaaaagaaaaaaaaagttatttttaaatgttcagtcactaacagccggcggttctggaaaccaaaagatagaaaagaatccatccaacagtcatatgtccttgctcctcaaacacccacaactccttgttaacgaggaaagcaaagagtcctccgaagaaaagatatggaccagaggtaccagtaaccttttggaatgcggtaaaccacgaatcgggcatcatcaagagacgagtctttggtgggtacattggacgagacgggtatggataattggtcaaatcccgatctgggtgctctttgaaatcttttggaacggatggaaggagttcaggagcggaccattctttattgcaggcatcgaacatggactttggagcttcagtctccgtcggcagtgggattcctgtaaaagaactataacaaaaaaaaacaatataatgcttacctttgaatctataagcaatcttctcaaaatacccgatgctgttatctgatgatggggcgacagcatctgaaacaaaaaattatatatgagaaaatgcatttaaataaactcacgtcctgttgcagctccacgcgcaacgataaaaacgcgagagaatgtctgaggagatgacaagcgactcaacgacatctggaa